1
Доступно поисковых запросов: 1 из 2
Следующий пробный период начнётся: 02 февраля 2022 в 07:50
Снять ограничение

ГОСТ 34104-2017

Корма и кормовые добавки. Метод идентификации генетически модифицированных линий сои, кукурузы и рапса c использованием ПЦР с гибридизационно-флуоресцентной детекцией в режиме реального времени
Действующий стандарт
Проверено:  25.01.2022

Информация

Название Корма и кормовые добавки. Метод идентификации генетически модифицированных линий сои, кукурузы и рапса c использованием ПЦР с гибридизационно-флуоресцентной детекцией в режиме реального времени
Название английское Feed and feed additives. Method of identification of genetically modified events of soybean, maize and rapeseed using PCR with hybridization-fluorescence detection in real time
Дата актуализации текста 01.01.2021
Дата актуализации описания 01.01.2021
Дата издания 23.07.2020
Дата введения в действие 01.07.2018
Область и условия применения Настоящий стандарт распространяется на корма: фуражное зерно, продукты его переработки; растительные корма; комбикорма для продуктивных и непродуктивных животных и сырье для их производства; кормовые добавки и устанавливает метод идентификации генно-модифицированной сои, генно-модифицирован-ной кукурузы и генно-модифицированного рапса методом полимеразной цепной реакции с гибридизационно-флуоресцентной детекцией в режиме реального времени (Real Time PCR
Опубликован Официальное издание. М.: Стандартинформ, 2020 год
Утверждён в Федеральное агентство по техническому регулированию и метрологии
Дата принятия 28.06.2017

ГОСТ 34104-2017

МЕЖГОСУДАРСТВЕННЫЙ СТАНДАРТ

КОРМА И КОРМОВЫЕ ДОБАВКИ

Метод идентификации генетически модифицированных линий сои, кукурузы и рапса с использованием ПЦР с гибридизационно-флуоресцентной детекцией в режиме реального времени

Feed and feed additives. Method of identification of genetically modified events of soybean, maize and rapeseed using PCR with hybridization-fluorescence detection in real time



МКС 65.120

Дата введения 2018-07-01

Предисловие


Цели, основные принципы и общие правила проведения работ по межгосударственной стандартизации установлены ГОСТ 1.0 "Межгосударственная система стандартизации. Основные положения" и ГОСТ 1.2 "Межгосударственная система стандартизации. Стандарты межгосударственные, правила и рекомендации по межгосударственной стандартизации. Правила разработки, принятия, обновления и отмены"

Сведения о стандарте

1 РАЗРАБОТАН Федеральным государственным бюджетным учреждением "Всероссийский государственный Центр качества и стандартизации лекарственных средств для животных и кормов" (ФГБУ "ВГНКИ")

2 ВНЕСЕН Федеральным агентством по техническому регулированию и метрологии

3 ПРИНЯТ Межгосударственным советом по стандартизации, метрологии и сертификации (протокол от 1 июня 2017 г. N 51)

За принятие проголосовали:

Краткое наименование страны по МК (ИСО 3166) 004-97

Код страны по
МК (ИСО 3166) 004-97

Сокращенное наименование национального органа по стандартизации

Армения

AM

Минэкономики Республики Армения

Беларусь

BY

Госстандарт Республики Беларусь

Казахстан

KZ

Госстандарт Республики Казахстан

Киргизия

KG

Кыргызстандарт

Россия

RU

Росстандарт

Таджикистан

TJ

Таджикстандарт

Узбекистан

UZ

Узстандарт

4 Приказом Федерального агентства по техническому регулированию и метрологии от 28 июня 2017 г. N 593-ст межгосударственный стандарт ГОСТ 34104-2017 введен в действие в качестве национального стандарта Российской Федерации с 1 июля 2018 г.

5 ВВЕДЕН ВПЕРВЫЕ

6 ПЕРЕИЗДАНИЕ. Май 2020 г.


Информация о введении в действие (прекращении действия) настоящего стандарта и изменений к нему на территории указанных выше государств публикуется в указателях национальных стандартов, издаваемых в этих государствах, а также в сети Интернет на сайтах соответствующих национальных органов по стандартизации.
     
     В случае пересмотра, изменения или отмены настоящего стандарта соответствующая информация будет опубликована на официальном интернет-сайте Межгосударственного совета по стандартизации, метрологии и сертификации в каталоге "Межгосударственные стандарты"


     1 Область применения


Настоящий стандарт распространяется на корма: фуражное зерно, продукты его переработки; растительные корма; комбикорма для продуктивных и непродуктивных животных и сырье для их производства; кормовые добавки и устанавливает метод идентификации генно-модифицированной сои (далее - ГМ сои), генно-модифицированной кукурузы (далее - ГМ кукурузы) и генно-модифицированного рапса (далее - ГМ рапса) методом полимеразной цепной реакции (далее - ПЦР) с гибридизационно-флуоресцентной детекцией в режиме реального времени (Real Time PCR).

     2 Нормативные ссылки


В настоящем стандарте использованы нормативные ссылки на следующие межгосударственные стандарты:

ГОСТ 12.0.004 Система стандартов безопасности труда. Организация обучения безопасности труда. Общие положения

ГОСТ 12.1.004 Система стандартов безопасности труда. Пожарная безопасность. Общие требования

ГОСТ 12.1.005 Система стандартов безопасности труда. Общие санитарно-гигиенические требования к воздуху рабочей зоны

ГОСТ 12.1.007 Система стандартов безопасности труда. Вредные вещества. Классификация и общие требования безопасности

ГОСТ 12.1.019 Система стандартов безопасности труда. Электробезопасность. Общие требования и номенклатура видов защиты

ГОСТ 12.4.009 Система стандартов безопасности труда. Пожарная техника для защиты объектов. Основные виды. Размещение и обслуживание

ГОСТ ISO 6497 Корма. Отбор проб

ГОСТ ISO 7218 Микробиология пищевых продуктов и кормов для животных. Общие требования и рекомендации по микробиологическим исследованиям

ГОСТ ISO/IEC 17025 Общие требования к компетентности испытательных и калибровочных лабораторий

ГОСТ 24760 Халаты медицинские женские. Технические условия

ГОСТ 25194 Халаты медицинские мужские. Технические условия

ГОСТ 26678 Холодильники и морозильники бытовые электрические компрессионные параметрического ряда. Общие технические условия

ГОСТ 31719-2012 Продукты пищевые и корма. Экспресс-метод определения сырьевого состава (молекулярный)


Примечание - При пользовании настоящим стандартом целесообразно проверить действие ссылочных стандартов и классификаторов на официальном интернет-сайте Межгосударственного совета по стандартизации, метрологии и сертификации (www.easc.by) или по указателям национальных стандартов, издаваемым в государствах, указанных в предисловии, или на официальных сайтах соответствующих национальных органов по стандартизации. Если на документ дана недатированная ссылка, то следует использовать документ, действующий на текущий момент, с учетом всех внесенных в него изменений. Если заменен ссылочный документ, на который дана датированная ссылка, то следует использовать указанную версию этого документа. Если после принятия настоящего стандарта в ссылочный документ, на который дана датированная ссылка, внесено изменение, затрагивающее положение, на которое дана ссылка, то это положение применяется без учета данного изменения. Если ссылочный документ отменен без замены, то положение, в котором дана ссылка на него, применяется в части, не затрагивающей эту ссылку.

     3 Термины и определения


В настоящем стандарте применены следующие термины с соответствующими определениями:

3.1 амплификация: Процесс, многократно увеличивающий число копий фрагмента генома какого-либо организма.

3.2 генно-модифицированные (генно-инженерные, трансгенные) организмы; ГМО: Организм или несколько организмов, любое неклеточное, одноклеточное или многоклеточное образование, способные к воспроизводству или передаче наследственного генетического материала, отличные от природных организмов, полученные с применением методов генной инженерии и/или содержащие генно-инженерный материал, в том числе гены, их фрагменты или комбинации генов.

3.3 линия генно-модифицированного растения (генетически модифицированная линия, ГМ линия): Потомство от одного определенного генно-инженерно-модифицированного организма.

3.4 нуклеиновые кислоты; НК: Макромолекулы, являющиеся носителями генетической информации или выступающие в качестве посредника при синтезе полипептидной цепи.

3.5 нуклеотидная последовательность: Порядок чередования нуклеотидных остатков в НК.

3.6 отрицательный контроль ПЦР; К-: Реакционная смесь для проведения ПЦР, заведомо не содержащая целевой нуклеиновый материал.

3.7 отрицательный контроль выделения (контроль чистоты выделения); КВ: Контроль, прошедший все этапы выделения ДНК, но в отсутствие анализируемой пробы.

3.8 отрицательный контрольный образец; ОКО: Реакционная смесь, используемая вместо анализируемой пробы для контроля чистоты выделения ДНК.

3.9 полимеразная цепная реакция; ПЦР: Циклический ферментативный процесс, результатом которого является получение многочисленных копий определенного участка молекулы ДНК.

3.10 положительный контроль ПЦР; К+: Реакционная смесь для проведения ПЦР, заведомо содержащая целевой нуклеиновый материал.

3.11 полимеразная цепная реакция в режиме реального времени: Полимеразная цепная реакция, проводимая по специальной технологии, которая позволяет регистрировать накопление ПЦР-продуктов в процессе амплификации.

3.12 ПЦР-продукт: Фрагмент ДНК, амплифицированный в ПЦР.

3.13 праймер: Искусственно синтезируемая короткая последовательность нуклеотидов, комплементарная определенному участку целевой ДНК, используемая в полимеразной цепной реакции.

3.14 промотор: Последовательность нуклеотидов в молекуле ДНК, ответственная за начало транскрипции.

3.15 пороговый цикл Ct: Цикл амплификации, в котором кривая флуоресценции исследуемого образца пересекает линию порога (Threshold).

3.16 терминатор: Последовательность нуклеотидов в молекуле ДНК, ответственная за прекращение транскрипции.

3.17 целевая ДНК: Выбранная для амплификации последовательность ДНК.

3.18 экстракция ДНК: Обработка анализируемой пробы, высвобождающая ДНК.

3.19 элюция: Извлечение вещества из твердого носителя вымыванием подходящим растворителем.

     4 Условия выполнения исследований и требования безопасности

4.1 Условия выполнения исследований

4.1.1 Общие требования к помещениям - по ГОСТ ISO 7218, ГОСТ ISO/IEC 17025, ГОСТ 31719 (приложение А).

4.1.2 Требования к персоналу - по ГОСТ ISO 7218 и ГОСТ ISO/IEC  17025.

4.2 Требования безопасности

4.2.1 В лаборатории должно быть организовано обучение персонала безопасности труда в соответствии с ГОСТ 12.0.004.

4.2.2 При работе с химическими реактивами необходимо соблюдать общие требования безопасности обращения с вредными веществами, установленные ГОСТ 12.1.007.

4.2.3 Содержание вредных веществ в воздухе рабочей зоны не должно превышать норм, установленных ГОСТ 12.1.005.

4.2.4 При работе с электроустановками следует соблюдать требования электробезопасности, установленные в ГОСТ 12.1.019.

4.2.5 Помещение лаборатории должно соответствовать требованиям пожарной безопасности по ГОСТ 12.1.004, должно быть оснащено средствами пожаротушения по ГОСТ 12.4.009.

     5 Оборудование, материалы, реагенты

5.1 Общие требования к оборудованию - по ISO/IEC 17025*.

________________

* Доступ к международным и зарубежным документам, упомянутым в тексте, можно получить, обратившись в Службу поддержки пользователей. - Примечание изготовителя базы данных.

5.2 При проведении испытаний применяют оборудование и материалы по ГОСТ 31719, с дополнением:

- бокс ламинарный, класс биологической безопасности II тип А2;

- термостат, обеспечивающий температуру нагрева до 100°C;

- отсасыватель вакуумный медицинский с колбой-ловушкой для удаления надосадочной жидкости;

- центрифуга для микропробирок вместимостью 1,5 см, со скоростью вращения не менее 12000 об/мин;

- миницентрифуги-встряхиватели с роторами для микропробирок вместимостью 0,2; 0,6 и 1,5 см, со скоростью вращения не менее 2400 об/мин;

- микропробирки одноразовые полипропиленовые завинчивающиеся или плотно закрывающиеся вместимостью 1,5 см;

- микропробирки одноразовые полипропиленовые вместимостью 0,2 см;

- одноразовые наконечники для дозаторов переменного объема с аэрозольным барьером объемом 10 мм, 100 мм, 200 мм, 1000 мм;

- ПЦР-бокс;

- прибор для проведения полимеразной цепной реакции в режиме реального времени*;

________________

* Прибор для проведения ПЦР "Rotor-Gene" 2000/3000/6000 ("Corbett Research", Австралия), "Rotor Gene Q" ("Qiagen", Германия). Данная информация является рекомендуемой и приведена для удобства пользователей настоящего стандарта.


- халаты медицинские по ГОСТ 24760 и ГОСТ 25194;

- холодильник бытовой электрический по ГОСТ 26678, обеспечивающий поддержание температуры от 2°C до 8°C, с морозильной камерой, обеспечивающей поддержание температуры не выше минус 16°C.

Допускается использование другого оборудования, материалов с техническими характеристиками не ниже указанных.

Допускается использование роботизированных станций для пробоподготовки, выделения дезоксирибонуклеиновой кислоты (ДНК) и раскапывания готовой многокомпонентной смеси для ПЦР.

5.3 При проведении испытаний применяют реагенты для экстракции ДНК, реагенты, праймеры и зонды для проведения ПЦР и амплификации. Для экстракции ДНК допускается использовать готовые наборы*.

________________

* Примером могут служить наборы "ДНК-СОРБ-С" (ФГБУН ЦНИИ Эпидемиологии Роспотребнадзора, форма 1 ref К1-6-50/ver. 05/08/16), "Сорб-ГМО-А" и "Сорб-ГМО-Б" (ЗАО "Синтол", каталожный номер GM-503). Данная информация является рекомендуемой и приведена для удобства пользователей настоящего стандарта.

5.3.1 Реагенты:

а) набор реагентов для экстракции ДНК, включающий:

1) буфер для лизирующего реагента, содержащий хаотропный агент гуанидин хлорид;

2) лизирующий реагент, содержащий протеиназу К;

3) раствор для отмывки N 1 для очистки от клеточных белков, содержащий хаотропный агент гуанидин тиоцианат;

4) раствор для отмывки N 2 для очистки от солей, содержащий водный раствор изопропилового спирта;

5) сорбент (25%-ная взвесь частиц силикагеля SiO размером от 20 до 50 мкм в растворе Трис-HCI молярной концентрации 5 ммоль/дм);

6) буфер для элюции ДНК (ТЕ-буфер) - Трис-HCI молярной концентрации 10 ммоль/дм; натриевая соль этилендиаминтетрауксусной кислоты молярной концентрации 1 ммоль/дм;

б) вода деионизированная, класса чистоты I, свободная от рибонуклеаз, дезоксирибонуклеаз, неорганических и органических примесей с удельным сопротивлением не менее 18 Мом·см;

в) ПЦР-буферс MgCl;

г) смесь олигонуклеотидов (праймеры) по 5.3.2 или 5.3.3;

д) смесь олигонуклеотидов (зонды, меченные флуоресцентными красителями FAM и R6G) по 5.3.2 или 5.3.3;

е) раствор дезоксинуклеозидтрифосфатов (дНТФ), содержащий натриевые соли дНТФ со степенью очистки более 98% и концентрацией каждой 2 моль/дм;

ж) термостабильная Taq-полимераза;

и) сертифицированные стандартные образцы ГМ линий сои, ГМ линий кукурузы или ГМ линий рапса*.

________________

* Сертифицированные стандартные образцы производства IRMM, Бельгия; AOCS, США (материалы, состоящие из высушенной гомогенизированной муки соевых бобов, рапса или кукурузы, включающих смеси ГМ и не ГМ растений соответствующих видов, содержащие от 0,1% до 100% генетически модифицированных материалов). Данная информация является рекомендуемой и приведена для удобства пользователей настоящего стандарта.


Допускается использование других реагентов с техническими характеристиками не хуже указанных.

5.3.2 Для выявления фрагментов видоспецифичной ДНК растений допускается использование наборов реагентов (готовых тест-систем), содержащих праймеры, специфичные к ДНК определенного вида растений.

5.3.3 Допускается использование синтезированных олигонуклеотидных праймеров и зондов для идентификации ГМ линий сои, кукурузы и рапса. Список последовательностей всех используемых олигонуклеотидов приведен в таблицах 1-3, где указаны последовательности:

1) для прямых и обратных праймеров и зондов***, специфичных конкретной ГМ линии;

________________

*** Маркировки в наименовании: "F" - прямой праймер, "R" - обратный праймер, "P" - зонд.

2) прямых и обратных праймеров и зондов, специфичных фрагменту генома растения (ген лектина для сои, ген зеина для кукурузы, ген круциферина A для рапса).

Таблица 1 - Последовательности олигонуклеотидных праймеров и зондов для идентификации ГМ линий сои

Линия ГМ сои

Последова-
тельность

Наименование

5'-3' последовательность

40-3-2

Целевая

40-3-2F

GCCATGTTGTTAATTTGTGCCAT

40-3-2R

GAAGTTCATTTCATTTGGAGAGGAC

40-3-2P

FAM-CTTGAAAGATCTGCTAGAGTCAGCTTGTCAGCG-BHQ1

Растительная

Lec40-3-2F

TCCACCCCCATCCACATTT

Lec40-3-2R

GGCATAGAAGGTGAAGTTGAAGGA

Lec40-3-2P

R6G-AACCGGTAGCGTTGCCAGCTTCG-BHQ1

А5547-127

Целевая

A5547F

GCTATTTGGTGGCATTTTTCCA

A5547R

CACTGCGGCCAACTTACTTCT

А5547Р

FAM-CCGCAATGTCATACCGTCATCGTTGT-BHQ1

Растительная

LecA5547F

CTTTCTCGCACCAATTGACA

LecA5547R

TCAAACTCAACAGCGACGAC

LecA5547P

R6G-CCACAAACACATGCAGGTTATCTTGG-BHQ1

А2704-12

Целевая

A2704F

GCAAAAAAGCGGTTAGCTCCT

A2704R

ATTCAGGCTGCGCAACTGTT

А2704Р

FAM-CGGTCCTCCGATCGCCCTTCC-BHQ1

Растительная

LecA2704F

CACCTTTCTCGCACCAATTGACA

LecA2704R

TCAAACTCAACAGCGACGAC

LecA2704P

R6G-CCACAAACACATGCAGGTTATCTTGG-BHQ1

MON89788

Целевая

MON89788F

TCCCGCTCTAGCGCTTCAAT

MON89788R

TCCCGCTCTAGCGCTTCAA

MON89788P

FAM-CTGAAGGCGGGAAACGACAATCTG-BHQ1

Растительная

LecMON89788F

CCAGCTTCGCCGCTTCCTTC

LecMON89788R

GAAGGCAAGCCCATCTGCAAGCC

LecMON89788P

R6G-CTTCACCTTCTATGCCCCTGACAC-BHQ1

MON87701

Целевая

MON87701F

TGGTGATATGAAGATACATGCTTAGCAT

MON87701R

CGTTTCCCGCCTTCAGTTTAAA

MON87701P

FAM-TCAGTGTTTGACACACACACTAAGCGTGCC-BHQ1

Растительная

Lec87701F

CCAGCTTCGCCGCTTCCTTC

Lec87701R

GAAGGCAAGCCCATCTGCAAGCC

Lec87701P

R6G-CTTCACCTTCTATGCCCCTGACAC-BHQ1

BPS-CV127-9

Целевая

BPSF

AACAGAAGTTTCCGTTGAGCTTTAAGAC

BPSR

CATTCGTAGCTCGGATCGTGTAC

BPSP

FAM-TTTGGGGAAGCTGTCCCATGCCC-BHQ1

Растительная

LecBPSF

CCAGCTTCGCCGCTTCCTTC

LecBPSR

GAAGGCAAGCCCATCTGCAAGCC

LecBPSP

R6G-CTTCACCTTCTATGCCCCTGACAC-BHQ1

SYHTOH2

Целевая

SyhF

GGGAATTGGGTACCATGCC

SyhR

TGTGTGCCATTGGTTTAGGGT

SyhP

FAM-CCAGCATGGCCGTATCCGCAA-BHQ1

Растительная

LecSyhF

CCAGCTTCGCCGCTTCCTTC

LecSyhR

GAAGGCAAGCCCATCTGCAAGCC

LecSyhP

R6G-CTTCACCTTCTATGCCCCTGACAC-BHQ1

FG72

Целевая

FG72F

AGATTTGATCGGGCTGCAGG

FG72R

GCACGTATTGATGACCGCATTA

FG72P

FAM-AATGTGGTTCATCCGTCTTTTTTG-BHQ1

Растительная

LecFG72F

CTTTCTCGCACCAATTGACA

LecFG72R

TCAAACTCAACAGCGACGAC

LecFG72P

R6G-CCACAAACACATGCAGGTTATCTTGG-BHQ1

DP-305423

Целевая

305423F

CGTGTTCTCTTTTTGGCTAGC

305423R

GTGACCAATGAATACATAACACAAACTA

305423P

FAM-TGACACAAATGATTTTCATACAAAAGTCGAGA-BHQ1

DP-305423

Растительная

Lec305423F

CCAGCTTCGCCGCTTCCTTC

Lec305423R

GAAGGCAAGCCCATCTGCAAGCC

Lec305423P

R6G-CTTCACCTTCTATGCCCCTGACAC-BHQ1

DP-356043

Целевая

356043F

GTCGAATAGGCTAGGTTTACGAAAAA

356043R

TTTGATATTCTTGGAGTAGACGAGAGTGT

356043Р

FAM-CTCTAGAGATCCGTCAACATGGTGGAGCAC-BHQ1

Растительная

Lec356043F

CCAGCTTCGCCGCTTCCTTC

Lec356043R

GAAGGCAAGCCCATCTGCAAGCC

Lec356043P

R6G-CTTCACCTTCTATGCCCCTGACAC-BHQ1

MON87705

Целевая

Mon87705F

TTCCCGGACATGAAGCCATTTAC

Mon87705R

ACAACGGTGCCTTGGCCCAAAG

Mon87705P

FAM-AAGAGACTCAGGGTGTTGTTATCACTGCGG-BHQ1

Растительная

LecMon87705F

CCAGCTTCGCCGCTTCCTTC

LecMon87705R

GAAGGCAAGCCCATCTGCAAGCC

LecMon87705P

R6G-CTTCACCTTCTATGCCCCTGACAC-BHQ1

MON87708

Целевая

Mon87708F

TCATACTCATTGCTGATCCATGTAG

Mon87708R

AGAACAAATTAACGAAAAGACAGAACG

Mon87708P

FAM-TCCCGGACTTTAGCTCAAAATGCATGTA-BHQ1

Растительная

LecMon87708F

CCAGCTTCGCCGCTTCCTTC

LecMon87708R

GAAGGCAAGCCCATCTGCAAGCC

LecMon87708P

R6G-CTTCACCTTCTATGCCCCTGACAC-BHQ1

MON87769

Целевая

Mon87769F

CATACTCATTGCTGATCCATGTAGATT

Mon87769R

GCAAGTTGCTCGTGAAGTTTTG

Mon87769P

FAM-CCCGGACATGAAGCCATTTACAATTGAC-BHQ1

Растительная

LecMon87769F

CCAGCTTCGCCGCTTCCTTC

LecMon87769R

GAAGGCAAGCCCATCTGCAAGCC

LecMon87769P

R6G-CTTCACCTTCTATGCCCCTGACAC-BHQ1

DAS-44406

Целевая

DAS-44406F

TTA TTG TTC TTG TTG TTT CCT CTT TAG G

DAS-44406R

CCT CAA TTG CGA GCT TTC TAA TTT

DAS-44406P

FAM-ATT CGG ACC TCC ATG ATG ACC TTA CCG TT-BHQ1

Растительная

LecDAS-44406F

CCA GCT TCG CCG CTT CCT TC

LecDAS-44406R

GAA GGC AAG CCC АТС TGC AAG CC

LecDAS-44406P

FAM-CTT CAC CTT СТА TGC CCC TGA CAC-BHQ1

DAS-81419

Целевая

DAS 81419F

TCT AGC СТА TAT TTA GCA CTT GAT ATT CAT

DAS 81419R

GCT TCA AGA TCC CAA CTT GCG

DAS 81419P

FAM-ATC AAC AGG CAC CGA TGC GCA CCG-BHQ1

DAS-81419

Растительная

Lec DAS81419F

CCA GCT TCG CCG CTT CCT TC

LecDAS81419R

GAA GGC AAG CCC АТС TGC AAG CC

LecDAS81419P

FAM-CTT CAC CTT СТА TGC CCC TGA CAC-BHQ1

DAS-68416

Целевая

DAS 68416F

GTA CAT TAA AAA CGT CCG CAA TGT GT

DAS 68416R

GTT TAA GAA TTA GTT CTT АСА GTT TAT TGT TAG

DAS 68416P

FAM-TTA AGT TGTCTA AGC GTC AAT A-MGBNFQ

Растительная

LecDAS68416F

CCA GCT TCG CCG CTT CCT TC

LecDAS68416R

GAA GGC AAG CCC АТС TGC AAG CC

LecDAS68416P

FAM-CTT CAC CTT СТА TGC CCC TGA CAC- BHQ1



Таблица 2 - Последовательности олигонуклеотидных праймеров и зондов для идентификации ГМ линий кукурузы

Линия ГМ кукурузы

Последова-
тельность

Наименование

5'-3' последовательность

GA21

Целевая

GA21 F

CTT ATC GTT ATG CTA TTT GCA ACT TTA GA

GA21 R

TGG CTC GCG ATС СTС СT

GA21 P

FAM-CAT ATA СTA ACT CAT ATС TСT TTС TСA AСA GCA GGT GGG T-BHQ1

Растительная

Adh GA21 F

CCA GCC TСA TGG CCA AAG

Adh GA21 R

CCT TCT TGG CGG CTT ATС TG

Adh GA21 P

R6G-CTT AGG GGC AGA CTC CCG TGT TСС CT-BHQ1

MON810

Целевая

Mon810 F

TCG AAG GAC GAA GGA CTC TAA CGT

Mon810 R

GCC ACC TTС CTT TTC CAC TAT CTT

Mon810 P

FAM-AAC ATС CTT TGC CAT TGC CCA GC-BHQ1

Растительная

Hmg Mon810 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg Mon810 R

GCT AСA TAG GGA GCC TTG TСС T

Hmg Mon810 P

R6G- CAA TСС AСA CAA ACG CAC GCG TA-BHQ1

MON89034

Целевая

Mon89034 F

TTC TCC ATA TTG ACC ATС ATA CTC ATT

Mon89034 R

CGG TAT СTA TAA TAC CGT GGT TTT TAA A

Mon89034 P

FAM-ATCCCCGGAAATTATGTT-MGBNFQ

Растительная

Hmg Mon89034 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg Mon89034 R

GCT AСA TAG GGA GCC TTG TСС T

Hmg Mon89034 P

R6G-CAA TСС AСA CAA ACG CAC GCG TA-BHQ1

NK603

Целевая

NK603 F

ATG AAT GAC CTC GAG TAA GCT TGT TAA

NK603 R

AAG AGA TAA CAG GAT CCA CTC AAA CAC T

NK603 P

FAM-TGG TAC CAC GCG AСA CAC TTC CAC TC-BHQ1

Растительная

Agh NK603 F

CCA GCC TCA TGG CCA AAG

Agh NK603 R

CCT TCT TGG CGG CTT ATС TG

Agh NK603 P

R6G-CTT AGG GGC AGA CTC CCG TGT TСС CT-BHQ1

Bt11

Целевая

Bt11 F

GCG GAA CCC СTA TTT GTT TA

Bt11 R

TCC AAG AAT CCC TCC ATG AG

Bt11 P

FAM-AAA TAC ATT CAA ATA TGT ATС CGC TCA-BHQ1

Растительная

Adh Bt11 F

CGT CGT TTC CCA TCT CTT CCT CC

Adh Bt11 R

CCA CTC CGA GAC CCT CAG TC

Adh Bt11 P

R6G-AAT CAG GGC TCA TTT TCT CGC TCC TCA -BHQ1

Т25

Целевая

T25 F

AСA AGC GTG TCG TGC TCC AC

T25 R

GAC ATG ATA CTC CTT CCA CCG

T25 P

FAM-TCA TTG AGT CGT TCC GCC ATT GTC G-BHQ1

Растительная

Adh T25 F

CGT CGT TTC CCA TCT CTT CCT CCT

Adh T25 R

CCA CTC CGA GAC CCT CAG TC

Adh T25 P

R6G-AAT CAG GGC TCA TTT TCT CGC TCC TCA-BHQ1

MIR604

Целевая

MIR604 F

GCG CAC GCA ATT CAA CAG

MIR604 R

GGT CAT AAC GTG ACT CCC TTA ATT CT

MIR604 P

FAM-AGGCGGGAAACGACAATCTGATCATG-BHQ1

Растительная

Adh MIR604 F

CGT CGT TTC CCA TCT CTT CCT CC

Adh MIR604 R

CCA CTC CGA GAC CCT CAG TC

Adh MIR604 P

R6G-AAT CAG GGC TCA TTT TCT CGC TCC TCA-BHQ1

MON 88017

Целевая

MON 88017 F

GAG CAG GAC CTG CAG AAG CT

MON 88017 R

TCC GGA GTT GAC CAT CCA

MON 88017 P

FAM-TCC CGC CTT CAG TTT AAA CAG AGT CGG GT -BHQ1

Растительная

Hmg MON 88017 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg MON 88017 R

GCT AСA TAG GGA GCC TTG TCC T

Hmg MON 88017 P

R6G-CAA TCC AСA CAA ACG CAC GCG TA -BHQ1

3272

Целевая

3272 F

TCA TCA GAC CAG ATT CTC TTT TAT GG

3272 R

CGT TTC CCG CCT TCA GTT TA

3272 P

FAM-ACT GCT GAC GCG GCC AAA CAC TG-BHQ1

Растительная

Adh 3272 F

CGT CGT TTC CCA TCT CTT CCT CC

Adh 3272 R

CCA CTC CGA GAC CCT CAG TC

Adh 3272 P

R6G-AAT CAG GGC TCA TTT TCT CGC TCC TCA-BHQ1

MIR162

Целевая

MIR162 F

GCG CGG TGT CAT СTA TGT TAC TAG

MIR162 R

TGC CTT ATС TGT TGC CTT CAG A

MIR162 P

FAM-TCT AGA CAA TTC AGT AСA TTA AAA ACG TCC GCC A-BHQ1

Растительная

Adh MIR162 F

CGT CGT TTC CCA TCT CTT CCT CC

Adh MIR162 R

CCA CTC CGA GAC CCT CAG TC

Adh MIR162 P

R6G- AAT CAG GGC TCA TTT TCT CGC TCC TCA-BHQ1

5307

Целевая

5307 F

CAT GGC CGT ATС CGC AAT GTG

5307 R

TGC ACC CTT TGC CAG TGG

5307 P

FAM-ACC AСA ATA TAC CCT CTT CCC TGG GCC AG-BHQ1

Растительная

Adh 5307 F

CGT CGT TTC CCA TCT CTT CCT CC

Adh 5307 R

CCA CTC CGA GAC CCT CAG TC

Adh 5307 P

R6G-AAT CAG GGC TCA TTT TCT CGC TCC TCA-BHQ1

Bt176

Целевая

Bt176 F

GGC CGT GAA CGA GCT GTT

Bt176 R

GGG AAG AAG CCT AСA TGT TTT СTA A

Bt176 P

FAM-AGC AAC CAG ATС GGC CGA CAC C-BHQ1

Растительная

Adh Bt176 F

CGT CGT TTC CCA TCT CTT CCT CC

Adh Bt176 R

CCA CTC CGA GAC CCT CAG TC

Adh Bt176 P

R6G-AAT CAG GGC TCA TTT TCT CGC TCC TCA-BHQ1

MON 98140

Целевая

MON 98140 F

GTG TGT ATG TCT CTT TGC TTG GTC TT

MON 98140 R

GAT TGT CGT TTC CCG CCT TC

MON 98140 P

FAM-CTC TAT CGA TCC CCC TCT TTG ATA GTT TAA ACT-BHQ1

Растительная

Hmg 98140 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg 98140 R

GCT AСA TAG GGA GCC TTG TCC T

Hmg 98140 P

R6G-CAA TCC AСA CAA ACG CAC GCG TA-BHQ1

MON87460

Целевая

Mon87460 F

CAC GTT GAA GGA AAA TGG ATT G

Mon87460 R

TCG CGA TCC TCC TCA AAG AC

Mon87460 P

FAM-AGG GAG TAT GTA GAT AAA TTT TCA AAG CGT TAG ACG GC-BHQ1

Растительная

Hmg Mon87460 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg Mon87460 R

GCT AСA TAG GGA GCC TTG TCC T

Hmg Mon87460 P

R6G-CAA TCC AСA CAA ACG CAC GCG TA-BHQ1

MON863

Целевая

Mon863 F

GTA GGA TCG GAA AGC TTG GTA С

Mon863 R

TGT TAC GGC СTA AAT GCT GAA CT

Mon863 P

FAM-TGA AСA CCC ATС CGA AСA AGT AGG GTC A-BHQ1

Растительная

Adh Mon863 F

CCA GCC TCA TGG CCA AAG

Adh Mon863 R

CCT TCT TGG CGG CTT ATС TG

Adh Mon863 P

R6G-CTT AGG GGC AGA CTC CCG TGT TCC CT-BHQ1

ТС1507

Целевая

TC1507 F

TAG TCT TCG GCC AGA ATG G

TC1507 R

CTT TGC CAA GAT CAA GCG

TC1507 P

FAM-TAA CTC AAG GCC CTC ACT CCG-BHQ1

Растительная

Hmg TC1507 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg TC1507 R

GCT AСA TAG GGA GCC TTG TCC T

Hmg TC1507 P

R6G-CAA TCC AСA CAA ACG CAC GCG TA-BHQ1

59122

Целевая

59122 F

GGGATAAGCAAGTAAAAGCGCTC

59122 R

CCTTAATTCTCCGCTCATGATCAG

59122 P

FAM-TTTAAACTGAAGGCGGGAAACGACAA-BHQ1

Растительная

Hmg 59122 F

GCT AСA TAG GGA GCC TTG TСС T

Hmg 59122 R

TTG GAC TAG AAA TCT CGT GCT GA

Hmg 59122 P

R6G-CAA TСС AСA CAA ACG CAC GCG TA-BHQ1

LY038

Целевая

LY038 F

TGG GTT CAG TCT GCG AAT GTT

LY038 R

AGG AAT TCG ATA TCA AGC TTA TCG A

LY038 P

FAM-CGA GCG GAG TTT ATG GGT CGA CGG-BHQ1

Растительная

Hmg LY038 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg LY038 R

GCT AСA TAG GGA GCC TTG TСС T

Hmg LY038 P

R6G-CAA TСС AСA CAA ACG CAC GCG TA-BHQ1

DAS-40278-9

Целевая

DAS40278 F

CAC GAA CCA TTG AGT TAC AAT С

DAS40278 R

TGG TTC ATT GTA TTC TGG CTT TG

DAS40278 P

FAM-CGT AGC TAA CCT TCA TTG TAT TCC G-BHQ1

Растительная

Hmg 40278 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg 40278 R

GCT AСA TAG GGA GCC TTG TСС T

Hmg 40278 P

R6G-CAA TСС AСA CAA ACG CAC GCG TA-BHQ1



Таблица 3 - Последовательности олигонуклеотидных праймеров и зондов для идентификации ГМ линий рапса

Линия ГМ рапса

Последова-
тельность

Наименование

5'-3' последовательность

GT73

Целевая

RT73-F

CCATATTGACCATCATACTCATTGCT

RF3-R*

GCTTATACGAAGGCAAGAAAAGGA

RT73-Z

FAM-TTCCCGGACATGAAGATCATCCTCCTT-BHQ1

Растительная

Rape-cruA-F

GGCCAGGGTTTCCGTGAT

Rape-cruA-R

CCGTCGTTGTAGAACCATTGG

Rape-cruA-Z

R6G-AGTCCTTATGTGCTCCACTTTCTGGTGCA-BHQ1

MON88302

Целевая

MON88302-F

TCCTTGAACCTTATTTTATAGTGCACA

MON88302-R

TCAGATTGTCGTTTCCCGCCTTCA

MON88302-Z

FAM-TAGTCATCATGTTGTACCACTTCAAACACT-BHQ1

Растительная

Rape-cruA-F

GGCCAGGGTTTCCGTGAT

Rape-cruA-R

CCGTCGTTGTAGAACCATTGG

Rape-cruA-Z

R6G-AGTCCTTATGTGCTCCACTTTCTGGTGCA-BHQ1

MS1

Целевая

Ms1-F*

ACGCTGCGGACATCTACATT

_________________

     * Текст документа соответствует оригиналу. - Примечание изготовителя базы данных.

    

MS1-R

CTAGATCGGAAGCTGAAGATGG

MS1-Z

FAM-CTCATTGCTGATCCACCTAGCCGACTT-BHQ1

MS1

Растительная

Rape-cruA-F

GGCCAGGGTTTCCGTGAT

Rape-cruA-R

TCAGATTGTCGTTTCCCGCCTTCA

Rape-cruA-Z

R6G-AGTCCTTATGTGCTCCACTTTCTGGTGCA-BHQ1

MS8

Целевая

MS8-F

GTTAGAAAAAGTAAACAATTAATATAGCCGG

MS8-R

GGAGGGTGTTTTTGGTTATC

MS8-Z

FAM-AATATAATCGACGGATCCCCGGGAATTC-BHQ1

Растительная

Rape-cruA-F

GGCCAGGGTTTCCGTGAT

Rape-cruA-R

TCAGATTGTCGTTTCCCGCCTTCA

Rape-cruA-Z

R6G-AGTCCTTATGTGCTCCACTTTCTGGTGCA-BHQ1

Т45

Целевая

T45-F

CAATGGACACATGAATTATGC

T45-R

GACTCTGTATGAACTGTTCGC

T45-Z

FAM-TAGAGGACCTAACAGAACTCGCCGT-BHQ1

Растительная

Rape-cruA-F

GGCCAGGGTTTCCGTGAT

Rape-cruA-R

TCAGATTGTCGTTTCCCGCCTTCA

Rape-cruA-Z

R6G-AGTCCTTATGTGCTCCACTTTCTGGTGCA-BHQ1

RF1

Целевая

RF1-F

CTAAGGGAGGTCAAGATGTAGC

RF1-R

CGGGCCTAACTTTTGGTGTG

RF1-Z

FAM-CTCATCATCCTCACCCAGTCAGCATCA-BHQ1

Растительная

Rape-cruA-F

GGCCAGGGTTTCCGTGAT

Rape-cruA-R

TCAGATTGTCGTTTCCCGCCTTCA

Rape-cruA-Z

R6G-AGTCCTTATGTGCTCCACTTTCTGGTGCA-BHQ1

RF2

Целевая

RF2-F

GGGTGAGACAATATATCGACG

RF2-R

GGGCATCGCACCGGTGAG

RF2-Z

FAM-CACCGGCCAAATTCGCTCTTAGCCGT-BHQ1

Растительная

Rape-cruA-F

GGCCAGGGTTTCCGTGAT

Rape-cruA-R

TCAGATTGTCGTTTCCCGCCTTCA

Rape-cruA-Z

R6G-AGTCCTTATGTGCTCCACTTTCTGGTGCA-BHQ1

RF3

Целевая

RF3-F

CATAAAGGAAGATGGAGACTTGAG

RF3-R

AGCATTTAGCATGTACCATCAGACA

RF3-Z

FAM-CGCACGCTTATCGACCATAAGCCCA-BHQ1

Растительная

Rape-cruA-F

GGCCAGGGTTTCCGTGAT

Rape-cruA-R

TCAGATTGTCGTTTCCCGCCTTCA

Rape-cruA-Z

R6G-AGTCCTTATGTGCTCCACTTTCTGGTGCA-BHQ1

Topas 19/2

Целевая

TOPAS19/2-F

GTTGCGGTTCTGTCAGTTCC

TOPAS19/2-R

CGACCGGCGCTGATATATGA

TOPAS19/2-Z

FAM-TCCCGCGTCATCGGCGG-BHQ1

Растительная

Rape-cruA-F

GGCCAGGGTTTCCGTGAT

Rape-cruA-R

TCAGATTGTCGTTTCCCGCCTTCA

Rape-cruA-Z

R6G-AGTCCTTATGTGCTCCACTTTCTGGTGCA-BHQ1


     6 Сущность метода

6.1 Сущность метода идентификации ГМ линий сои, кукурузы и рапса методом ПЦР с гибридизационно-флуоресцентной детекцией в режиме реального времени (Real Time PCR) заключается в проведении двух независимых ПЦР в одной пробирке с использованием специфичных праймеров и зондов, меченных флуоресцентными красителями, с целью выявления участка видоспецифичной ДНК растений (сои, кукурузы или рапса) и части генно-инженерной конструкции, специфичной для генома тестируемой генетически модифицированной линии.

6.2 Метод состоит из следующих этапов:

- экстракция и очистка ДНК: на данном этапе осуществляется лизис клеток с последующей очисткой ДНК от балластных веществ (белков, полисахаридов и других соединений);

- ПЦР с использованием специфических праймеров и зондов, меченных флуоресцентным красителем. На данном этапе осуществляется накопление копий целевого участка ДНК и детекция ПЦР-продуктов в режиме "реального времени";

- анализ и интерпретация результатов происходит на основании наличия (или отсутствия) пересечения кривой флюоресценции с установленной на соответствующем уровне пороговой линией на графике зависимости интенсивности флюоресценции от количества циклов, что соответствует значениям порогового цикла "Ct".

     7 Отбор проб


Общие правила отбора проб для испытаний должны соблюдаться в соответствии с требованиями ГОСТ ISO 6497.

     8 Экстракция ДНК

8.1 Экстракцию ДНК из анализируемой пробы осуществляют с использованием набора реагентов для экстракции ДНК сорбционным методом по 5.3 или иным методом, позволяющим получить достаточный объем ДНК для последующих исследований. Объем ДНК, необходимый для проведения исследований, вычисляют по формулам:

,                                                (1)


где V - объем ДНК, необходимый для проведения идентификации линий;

N - количество идентифицируемых линий;

,                                                (2)


где V - объем ДНК, необходимый для проведения количественного анализа.

8.2 Буфер для лизирующего реагента и раствор для отмывки N 1 (если они хранились при температуре от 2°C до 8°C) прогревают на поверхности твердотельного термостата при температуре от 60°C до 64°C до полного растворения кристаллов.

8.3 Отбирают необходимое количество одноразовых пробирок объемом 1,5 см (включая отрицательный контроль выделения). В пробирки вносят анализируемые пробы. В пробирку отрицательного контроля выделения ДНК вносят 100 мм ОКО.

8.4 Отдельными наконечниками с аэрозольным барьером вносят в каждую пробирку по 400 мм буфера для лизирующего реагента и по 17 мм лизирующего реагента. Тщательно перемешивают содержимое пробирок на встряхивателе в течение 10 с.

8.5 Пробирки инкубируют в термостате при температуре 64°C в течение 1 ч, периодически встряхивая на встряхивателе (пять раз через каждые 10-12 мин).

8.6 Нерастворенные частицы анализируемой пробы осаждают центрифугированием при 12-14 тыс. об/мин в течение 5 мин.

8.7 Надосадочную жидкость в объеме 200-350 мм очень аккуратно (так, чтобы не попали взвешенные частицы и капли жира) отбирают отдельными наконечниками с аэрозольными барьерами и переносят в новые пробирки.

8.8 Пробирки с надосадочной жидкостью прогревают в течение 5 мин в термостате при температуре 64°C, перемешивают содержимое пробирок и центрифугируют в течение 5 с при 5 тыс. об/мин для сброса капель с крышки пробирки.

8.9 В каждую пробирку отдельным наконечником добавляют по 25 мм сорбента, предварительно помещенного во встряхиватель для получения однородной суспензии. Содержимое пробирок перемешивают на встряхивателе и инкубируют при комнатной температуре в течение 10-15 мин, перемешивая через каждые 2 мин. Сорбент осаждают центрифугированием при 5 тыс. об/мин в течение 30 с. Надосадочную жидкость удаляют, используя вакуумный отсасыватель с колбой-ловушкой и отдельный наконечник для каждой пробы.

8.10 В пробирки добавляют по 300 мм раствора для отмывки N 1. Перемешивают на встряхивателе до полного ресуспендирования сорбента. Сорбент осаждают центрифугированием при 5 тыс. об/мин в течение 30 с. Удаляют надосадочную жидкость, используя вакуумный отсасыватель с колбой-ловушкой и отдельный наконечник для каждой пробы.

8.11 Процедуру отмывки повторяют дважды, используя по 500 мм раствора для отмывки N 2, и центрифугируют в течение 30 с при 7 тыс. об/мин, удаляют надосадочную жидкость полностью.

8.12 Пробирки с отмытым сорбентом помещают в термостат при температуре 64°C на 10 мин для подсушивания сорбента. При этом крышки пробирок должны быть открыты.

8.13 В пробирки добавляют по 50 мм буфера для элюции ДНК и перемешивают на встряхивателе. Помещают в термостат при температуре 64°C на 5 мин и периодически (один раз в минуту) встряхивают на встряхивателе. Пробирки центрифугируют при 12 тыс. об/мин в течение 1 мин.

8.14 Надосадочная жидкость содержит очищенную ДНК, которую затем используют для постановки ПЦР и проведения амплификации. Очищенную ДНК можно хранить в течение одной недели при температуре от 2°C до 8°C и в течение года при температуре не выше минус 16°C. Для этого рекомендуется перенести надосадочную жидкость в чистую микропробирку.

     9 Постановка ПЦР и проведение амплификации с гибридизационно-флуоресцентной детекцией в режиме реального времени (Real Time PCR)

9.1 Приготовление реакционной ПЦР-смеси


Для приготовления реакционной ПЦР-смеси для определения генетически модифицированной линии сои, кукурузы или рапса берут 1 мм деионизированной воды, по 1 мм каждого соответствующего праймера с маркировкой "F" по 5.3.2 концентрацией 5·10 моль/дм, по 1 мм каждого праймера с маркировкой "R" по 5.3.2 концентрацией 5·10 моль/дм, по 1 мм каждого зонда с маркировкой "Р" по 5.3.2 концентрацией 3·10 моль/дм, 3 мм раствора дНТФ и смешивают в пробирке вместимостью 1,5 см. Срок хранения готовой ПЦР-смеси при температуре не выше минус 18°C - не более 12 мес.

9.2 Постановка ПЦР

9.2.1 ДНК, экстрагированную из анализируемой пробы (включая стандартные образцы), испытывают не менее чем в двух повторностях.

9.2.2 Для проведения ПЦР в одной пробирке смешивают 10 мм ПЦР-смеси по 9.1, к которой добавляют 5 мм ПЦР-буфера и 0,5 мм термостабильной Taq полимеразы. Смесь перемешивают на встряхивателе, осаждая кратковременным центрифугированием.

9.2.3 Вносят по 15 мм смеси, полученной по 9.2.2, в микропробирку вместимостью 0,2 см, затем, используя наконечник с аэрозольным барьером, добавляют в нее 10 мм ДНК, полученной из анализируемой пробы (ДНК-проба) в соответствии с разделом 8. Общий объем реакционной смеси - 25 мм.

Примечание - Необходимо избегать попадания сорбента в реакционную смесь.

9.3 Контрольные реакции амплификации:

- отрицательный контроль ПЦР (К-) - вместо ДНК-пробы в микропробирку с 15 мм смеси по 9.2.2 вносят 10 ммТЕ-буфера;

- положительный контроль ПЦР (К+) - вместо ДНК-пробы в микропробирку с 15 мм смеси по 9.2.2 вносят 10 мм 1%-ного стандартного образца состава ГМ сои, ГМ кукурузы или ГМ рапса.

9.4 Проведение амплификации и детекции флуоресцентного сигнала

Программируют прибор для проведения полимеразной цепной реакции в режиме реального времени в соответствии с инструкцией по эксплуатации.

Программы амплификации для идентификации линий ГМ сои, кукурузы и рапса различаются для разных ГМ линий и приведены в таблицах 4-11.

Программа амплификации для идентификации ГМ сои линий 40-3-2, А5547-127, А2704-12 приведена в таблице 4.

Таблица 4 - Программа амплификации для идентификации ГМ линий сои 40-3-2, А5547-127, А2704-12

Стадия

Температура

Время

Количество циклов

Детекция

Удерживание

95°C

15 мин

1

-

Циклирование

95°C

15 с

45

-

60°C

30 с

По каналам FAM/Green, JOE/Yellow

72°C

30 с

-

-


Программа амплификации для идентификации ГМ сои линий MON87701, BPS-CV127-9, FG72 приведена в таблице 5.

Таблица 5 - Программа амплификации для идентификации ГМ линий сои MON87701, BPS-CV127-9, FG72

Стадия

Температура

Время

Количество циклов

Детекция

Hold/Удержание температуры

95°C

15 мин

1

-

Cycling 1/
Циклирование 1

95°C

10 c

10

-

60°C

20 с

-

72°C

10 с

-

Cycling 2/
Циклирование 2

95°C

10 с

35

-

55°C

20 с

По каналам FAM/Green, JOE/Yellow

72°C

10 с

-


Программа амплификации для идентификации ГМ сои линий MON89788, SYHTOH2, DP-305423, DP-356043, MON87705, MON87708, MON87769 приведена в таблице 6.

Таблица 6 - Программа амплификации для идентификации ГМ линий сои MON89788, SYHTOH2, DP-305423, DP-356043, MON87705, MON87708, MON87769

Стадия

Температура

Время

Количество циклов

Детекция

Hold/Удержание температуры

95°C

15 мин

1

-

Cycling/
Циклирование

95°C

15 с

45

-

60°C

60 с

По каналам FAM/Green, JOE/Yellow


Программа амплификации для идентификации ГМ сои линии DAS-44406, DAS-81419 приведена в таблице 7.

Таблица 7 - Программа амплификации для идентификации ГМ линий сои DAS-44406, DAS-81419

Стадия

Температура

Время

Количество циклов

Детекция

Hold/Удержание температуры

95°C

10 мин

1

-

Cycling/
Циклирование

95°C

15 с

40

-

60°C

60 с

По каналам FAM/Green, JOE/Yellow


Программа амплификации для идентификации ГМ сои линии DAS-68416 приведена в таблице 8.

Таблица 8 - Программа амплификации для идентификации ГМ линий сои DAS-68416

Стадия

Температура

Время

Количество циклов

Детекция

Hold/Удержание температуры

95°C

10 мин

1

-

Cycling/
Циклирование

95°C

15 с

45

-

60°C

60 с

По каналам FAM/Green, JOE/Yellow


Программа амплификации для идентификации ГМ кукурузы линий MON98140, MIR162, 5307, Bt176, MIR604, 3272 приведена в таблице 9.

Таблица 9 - Программа амплификации для идентификации ГМ линий кукурузы MON98140, MIR162, 5307, Bt176, MIR604, 3272

Стадия

Температура

Время

Количество циклов

Детекция

Hold/Удержание температуры

95°C

10 мин

1

Cycling/
Циклирование

95°C

15 с

40

-

60°C

60 с

По каналам FAM/Green, JOE/Yellow


Программа амплификации для идентификации ГМ кукурузы линий ТС1507, MON87460, LY038, DAS40278-9, MON89034, MON810, NK603, Т25, GA21, MON863, MON88017 приведена в таблице 10.

Таблица 10 - Программа амплификации для идентификации ГМ линий кукурузы ТС1507, MON87460, LY038, DAS40278-9, MON89034, MON810, NK603, Т25, GA21, MON863, MON88017

Стадия

Температура

Время

Количество циклов

Детекция

Hold/Удержание температуры

95°C

10 мин

1

-

Cycling/
Циклирование

95°C

15 с

45

-

60°C

60 с

По каналам FAM/Green, JOE/Yellow


Программа амплификации для идентификации ГМ кукурузы линий 59122, Bt11 приведена в таблице 11.

Таблица 11 - Программа амплификации для идентификации ГМ линий кукурузы 59122, Bt11

Стадия

Температура

Время

Количество циклов

Детекция

Hold/Удержание температуры

95°C

10 мин

1

-

Cycling/
Циклирование

95°C

15 с

50

-

60°C

60 с

По каналам FAM/Green, JOE/Yellow


Программа амплификации для идентификации ГМ рапса линий GT73, MON88302, RF2, MS1, MS8, Т45, RF1, RF3, Topas19/2 приведена в таблице 12.

Таблица 12 - Программа амплификации для идентификации ГМ линий рапса линий GT73, MON88302, RF2, MS1, MS8, Т45, RF1, RF3, Topas19/2

Стадия

Температура

Время

Количество циклов

Детекция

Hold/Удержание температуры

95°C

15 мин

1

-

Cycling/
Циклирование

95°C

15 с

40

-

60°C

60 с

По каналам FAM/Green, JOE/Yellow


Детекцию флуоресцентного сигнала проводят на каналах FAM и JOE. По каналу FAM регистрируют уровень флуоресценции участка части генно-инженерной конструкции, специфичной для генома тестируемой генетически модифицированной линии, по каналу JOE - для эндогенной ДНК ГМ сои, ГМ кукурузы, ГМ рапса. Кривые накопления флуоресцентного сигнала анализируют с использованием программного обеспечения используемого прибора для проведения ПЦР в режиме реального времени (Real Time PCR).

9.5 Учет и интерпретация результатов

9.5.1 Полученные в ходе испытания данные (кривые накопления флуоресцентного сигнала) анализируют по нескольким каналам детекции с использованием программного обеспечения прибора.

9.5.2 Результаты интерпретируют на основании наличия (или отсутствия) пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией на графике зависимости интенсивности флуоресценции от количества циклов, что соответствует значению порогового цикла Ct.

9.5.3 Учет результатов испытания следует начинать с результатов амплификации ДНК контрольных образцов в соответствии с таблицами оценки результатов контрольных реакций (таблицы 8-11). Для положительного контроля ПЦР в таблицах результатов по каналам FAM/Green и JOE/Yellow должны присутствовать значения порогового цикла Ct соответствующих значений в зависимости от программы амплификации. Для отрицательного контроля экстракции и отрицательного контроля ПЦР значения порогового цикла Ct по всем каналам должны отсутствовать. Отсутствие положительного сигнала в пробе с положительным контролем ПЦР (К+) или превышение граничного значения Ct, указанного в таблице, может свидетельствовать об ошибках, допущенных на этапе постановки ПЦР. В таком случае необходимо провести этап ПЦР повторно.

Таблица 13 - Оценка результатов контролей для таблиц 4, 6, 8, 10

Контроли

Контролируемый этап испытаний

Значение Ct по каналу

FAM/Green

JOE/Yellow

В-

Экстракция ДНК

Нет значений

Нет значений

К-

ПЦР

Нет значений

Нет значений

К+

ПЦР

31

31

Проба

31

31


В образце обнаружена ДНК сои/кукурузы, если для данной пробы в таблице результатов по каналу JOE/Yellow определено значение порогового цикла Ct35 (таблица 13). При получении значения Ct>35 по каналу JOE/Yellow для анализируемой пробы требуется повторное испытание данной пробы, начиная с первого этапа испытаний (экстракция ДНК). При повторном получении аналогичного результата образец считают не подлежащим испытанию из-за низкого содержания в нем ДНК кукурузы/сои.

ДНК ГМ линии считают обнаруженной, если для данной пробы в таблице результатов по каналу FAM/Green определено значение порогового цикла Ct37.

Таблица 14 - Оценка результатов контролем для таблиц 5, 7, 9

Контроли

Контролируемый этап испытаний

Значение Ct по каналу

FAM/Green

JOE/Yellow

В-

Экстракция ДНК

Нет значений

Нет значений

К-

ПЦР

Нет значений

Нет значений

К+

ПЦР

21

21

Проба

27

25


В образце обнаружена ДНК сои/кукурузы, если для данной пробы в таблице результатов по каналу JOE/Yellow определено значение порогового цикла Ct25 (таблица 14). При получении значения Ct>25 по каналу JOE/Yellow для анализируемой пробы требуется повторное испытание данной пробы, начиная с первого этапа испытаний (экстракция ДНК). При повторном получении аналогичного результата образец считают не подлежащим анализу из-за низкого содержания в нем ДНК кукурузы/сои.

ДНК ГМ линии обнаружена, если для данной пробы в таблице результатов по каналу FAM/Green определено значение порогового цикла Ct27.

Таблица 15 - Оценка результатов контролей для таблицы 11

Контроли

Контролируемый этап испытаний

Значение Ct по каналу

FAM/Green

JOE/Yellow

В-

Экстракция ДНК

Нет значений

Нет значений

К-

ПЦР

Нет значений

Нет значений

К+

ПЦР

35

35

Проба

40

37


В образце обнаружена ДНК кукурузы, если для данной пробы в таблице результатов по каналу JOE/Yellow определено значение порогового цикла Ct37 (таблица 15). При получении значения Ct>37 по каналу JOE/Yellow для анализируемой пробы требуется повторное испытание данной пробы, начиная с первого этапа испытаний (экстракция ДНК). При повторном получении аналогичного результата образец считают не подлежащим анализу из-за низкого содержания в нем ДНК кукурузы.

ДНК ГМ линии обнаружена, если для данной пробы в таблице результатов по каналу FAM/Green определено значение порогового цикла Ct40.

Таблица 16 - Оценка результатов контролей для таблицы 12

Контроли

Контролируемый этап испытаний

Значение Ct по каналу

FAM/Green

JOE/Yellow

В-

Экстракция ДНК

Нет значений

Нет значений

К-

ПЦР

Нет значений

Нет значений

К+

ПЦР

31

31

Проба

37

37


В образце обнаружена ДНК рапса, если для данной пробы в таблице результатов по каналу JOE/Yellow определено значение порогового цикла Ct37 (таблица 16). При получении значения Ct>37 по каналу JOE/Yellow для анализируемой пробы требуется повторное испытание данной пробы, начиная с первого этапа испытаний (экстракция ДНК). При повторном получении аналогичного результата образец считают не подлежащим анализу из-за низкого содержания в нем ДНК рапса.

ДНК ГМ линии обнаружена, если для данной пробы в таблице результатов по каналу FAM/Green определено значение порогового цикла Ct37.

9.5.4 Проверка условий достоверности испытаний

9.5.4.1 Отсутствие положительного сигнала в пробе с положительным контролем ПЦР (К+) или превышение граничных значений Ct, указанных в таблицах 13-16, может свидетельствовать о неправильно выбранной программе амплификации и о других ошибках, допущенных на этапе постановки ПЦР. В таком случае необходимо провести этап ПЦР повторно.

9.5.4.2 Появление любого значения Ct в таблице результатов для отрицательного контроля экстракции (на любом из каналов) и для отрицательного контроля ПЦР (на любом из каналов) свидетельствует о наличии контаминации реактивов или образцов. В этом случае результаты анализа по всем пробам считаются недействительными. Требуется повторить ПЦР-исследование всех проб, начиная с этапа экстракции ДНК, а также предпринять меры по выявлению и ликвидации источника контаминации.

9.5.4.3 При получении значения Ct в таблице результатов по каналам Yellow и/или Green для анализируемой пробы более указанных пороговых значений Ct требуется повторно провести ПЦР-исследование соответствующего образца, начиная с этапа экстракции ДНК. При повторном получении аналогичного результата образец считают не подлежащим анализу из-за низкого содержания в нем растительной ДНК и/или ДНК ГМ линии.

Приложение А
(справочное)

     

Требования к ПЦР-лаборатории

А.1 ПЦР-лаборатория должна быть разделена на зоны (отдельные комнаты или помещения) для каждой из стадий ПЦР-диагностики.

А.2 Рабочая зона ПЦР-лаборатории в соответствии с этапами ПЦР-исследования должна включать следующий минимальный набор изолированных помещений:

- приема и регистрации лабораторной пробы;

- первичной обработки лабораторной пробы, подготовки анализируемой пробы (I зона, отдельный ламинар);

- выделения НК из анализируемой пробы (I зона, отдельный ламинар).

Примечание - Помещения, где проводят работы по выделению и амплификации НК, располагают как можно дальше от помещения для детекции и учета результатов ПЦР с целью исключения движения воздушного потока и предотвращения контаминации продуктами амплификации (ампликонов), поскольку в процессе ПЦР фрагменты ДНК накапливаются в огромных количествах и являются идеальными продуктами для реамплификации;

- приготовления реакционных смесей, постановки ПЦР (II зона);

- гибридизационно-флюоресцентной детекции и учета результатов испытания методом Real Time PCR (III зона).

 
Рисунок А.1 - Схема ПЦР-лаборатории

А.3 Работа в ПЦР-лаборатории должна быть организована в одном направлении: от зон выделения и амплификации НК к зоне детекции и учета результатов ПЦР. В разных зонах лаборатории должны работать разные сотрудники.

А.4 Не допускается выполнение ПЦР-исследований в помещениях для проведения работ другими лабораторными и генно-инженерными методами (клонирование, секвенирование, рестрикционный анализ).

Все работы по подготовке испытуемых проб и выделению НК проводят в ламинарном боксе II, III классов защиты.

А.5 Каждая рабочая зона должна иметь свой набор лабораторной мебели, оборудования, реагентов, автоматических пипеток, расходных материалов, лабораторной посуды, защитной одежды, обуви, уборочного инвентаря и др. Имущество должно иметь маркировку, использование его в других помещениях или для проведения других работ запрещено.

А.6 Для проведения ПЦР-исследований необходимо использовать только одноразовые микропробирки и наконечники. Для предотвращения аэрозольного загрязнения автоматических пипеток используют наконечники с антиаэрозольным фильтром. Пробирки и наконечники для автоматических пипеток используют однократно. При переходе от одной пробы к другой обязательно меняют наконечники с целью предотвращения перекрестной контаминации в процессе выделения ДНК, РНК или при раскапывании реакционной смеси.

А.7 Работы по подготовке реакционной смеси для ПЦР, внесению выделенных НК в ПЦР-смесь проводят в ПЦР-боксах, оснащенных ультрафиолетовыми лампами.

Регулярно следует проводить мониторинг помещений, оборудования, рабочих поверхностей, дверных ручек на наличие продуктов амплификации.

УДК 636.086.15:636.086:006.354

МКС 65 120

Ключевые слова: корма и кормовые добавки, полимеразная цепная реакция, амплификация, праймеры, зонды, генно-модифицированная соя, генно-модифицированная кукуруза, генно-модифицированный рапс, экстракция ДНК, постановка ПЦР и проведение амплификации с гибридизационно-флуоресцентной детекцией в режиме реального времени (Real Time PCR)     

Закупки не найдены
Свободные
Р
Заблокированные
Р
Роль в компании Пользователь

Для продолжения необходимо войти в систему

После входа Вам также будет доступно:
  • Автоматическая проверка недействующих стандартов в закупке
  • Создание шаблона поиска
  • Добавление закупок в Избранное