1
Доступно поисковых запросов: 1 из 2
Следующий пробный период начнётся: 26 января 2022 в 16:45
Снять ограничение

ГОСТ 34179-2017

Продукция мясная сырокопченая и сыровяленая. Общие требования к проведению видовой идентификации стартовых культур, используемых при производстве сырокопченой и сыровяленой мясной продукции
Действующий стандарт
Проверено:  18.01.2022

Информация

Название Продукция мясная сырокопченая и сыровяленая. Общие требования к проведению видовой идентификации стартовых культур, используемых при производстве сырокопченой и сыровяленой мясной продукции
Название английское Smoked and dried meat products. General requirements for species-specific identification of starter cultures used in production of smoked and dried meat products
Дата актуализации текста 01.01.2021
Дата актуализации описания 01.01.2021
Дата издания 12.01.2018
Дата введения в действие 01.01.2019
Область и условия применения Настоящий стандарт распространяется на сырокопченую и сыровяленую мясную продукцию, в т. ч. из мяса птицы, и устанавливает общие требования к проведению видовой идентификации стартовых культур, используемых на всех этапах производства продукции, методом полимеразной цепной реакции (ПЦР) в режиме реального времени. Настоящий стандарт может быть применен для исследования готовых стартовых культур, выделенных на питательных средах целевых микроорганизмов
Опубликован Официальное издание. М.: Стандартинформ, 2018 год
Утверждён в Федеральное агентство по техническому регулированию и метрологии
Дата принятия 30.11.2017

     
     ГОСТ 34179-2017

     

МЕЖГОСУДАРСТВЕННЫЙ СТАНДАРТ

ПРОДУКЦИЯ МЯСНАЯ СЫРОКОПЧЕНАЯ И СЫРОВЯЛЕНАЯ

Общие требования к проведению видовой идентификации стартовых культур, используемых при производстве сырокопченой и сыровяленой мясной продукции

Smoked and dried meat products. General requirements for species-specific identification of starter cultures used in production of smoked and dried meat products



МКС 67.120.10

Дата введения 2019-01-01

     

Предисловие


Цели, основные принципы и основной порядок проведения работ по межгосударственной стандартизации установлены в ГОСТ 1.0-2015 "Межгосударственная система стандартизации. Основные положения" и ГОСТ 1.2-2015 "Межгосударственная система стандартизации. Стандарты межгосударственные, правила и рекомендации по межгосударственной стандартизации. Правила разработки, принятия, обновления и отмены"

Сведения о стандарте

1 РАЗРАБОТАН Федеральным государственным бюджетным научным учреждением "Всероссийский научно-исследовательский институт мясной промышленности имени В.М.Горбатова" (ФГБНУ "ВНИИМП им.В.М.Горбатова")

2 ВНЕСЕН Федеральным агентством по техническому регулированию и метрологии

3 ПРИНЯТ Межгосударственным советом по стандартизации, метрологии и сертификации (протокол от 30 июня 2017 г. N 100-П)

За принятие проголосовали:

Краткое наименование страны по МК (ИСО 3166) 004-97

Код страны по МК (ИСО 3166) 004-97

Сокращенное наименование национального органа по стандартизации

Беларусь

BY

Госстандарт Республики Беларусь

Киргизия

KG

Кыргызстандарт

Россия

RU

Росстандарт

Таджикистан

TJ

Таджикстандарт

Узбекистан

UZ

Узстандарт

Украина

UA

Минэкономразвития Украины

4 Приказом Федерального агентства по техническому регулированию и метрологии от 30 ноября 2017 г. N 1864-ст межгосударственный стандарт ГОСТ 34179-2017 введен в действие в качестве национального стандарта Российской Федерации с 1 января 2019 г.

5 ВВЕДЕН ВПЕРВЫЕ


Информация об изменениях к настоящему стандарту публикуется в ежегодном информационном указателе "Национальные стандарты", а текст изменений и поправок - в ежемесячном информационном указателе "Национальные стандарты". В случае пересмотра (замены) или отмены настоящего стандарта соответствующее уведомление будет опубликовано в ежемесячном информационном указателе "Национальные стандарты". Соответствующая информация, уведомление и тексты размещаются также в информационной системе общего пользования - на официальном сайте Федерального агентства по техническому регулированию и метрологии в сети Интернет (www.gost.ru)

     1 Область применения


Настоящий стандарт распространяется на сырокопченую и сыровяленую мясную продукцию, в том числе из мяса птицы, и устанавливает общие требования к проведению видовой идентификации стартовых культур, используемых на всех этапах производства продукции, методом полимеразной цепной реакции (ПЦР) в режиме реального времени.

Настоящий стандарт может быть применен для исследования готовых стартовых культур, выделенных на питательных средах целевых микроорганизмов.

     2 Нормативные ссылки


В настоящем стандарте использованы нормативные ссылки на следующие межгосударственные стандарты:

ГОСТ 12.1.004-91 Система стандартов безопасности труда. Пожарная безопасность. Общие требования

ГОСТ 12.1.005-88 Система стандартов безопасности труда. Общие санитарно-гигиенические требования к воздуху рабочей зоны

ГОСТ 12.1.007-76 Система стандартов безопасности труда. Вредные вещества. Классификация и общие требования безопасности

ГОСТ 12.1.019-79* Система стандартов безопасности труда. Электробезопасность. Общие требования и номенклатура видов защиты

_______________

* В Российской Федерации действует ГОСТ Р 12.1.019-2009.


ГОСТ 12.4.009-83 Система стандартов безопасности труда. Пожарная техника для защиты объектов. Основные виды. Размещение и обслуживание

ГОСТ 12.4.021-75 Система стандартов безопасности труда. Системы вентиляционные. Общие требования

ГОСТ OIML R 76-1-2011 Государственная система обеспечения единства измерений. Весы неавтоматического действия. Часть 1. Метрологические и технические требования. Испытания

ГОСТ ISO 3696-2013** Вода для лабораторного анализа. Технические требования и методы контроля

_______________

** В Российской Федерации действует ГОСТ Р 52501-2005 (ИСО 3696:1987) "Вода для лабораторного анализа. Технические условия".


ГОСТ 4209-77 Реактивы. Магний хлористый 6-водный. Технические условия

ГОСТ 5962-2013 Спирт этиловый ректификованный из пищевого сырья. Технические условия

ГОСТ 6709-72 Вода дистиллированная. Технические условия

ГОСТ 9147-80 Посуда и оборудование лабораторные фарфоровые. Технические условия

ГОСТ 9792-73 Колбасные изделия и продукты из свинины, баранины, говядины и мяса других видов убойных животных и птиц. Правила приемки и методы отбора проб

ГОСТ 10444.11-2013 (ISO 15214:1998) Микробиология пищевых продуктов и кормов для животных. Методы выявления и подсчета количества мезофильных молочнокислых микроорганизмов

ГОСТ ISO 16140-2011 Микробиология продуктов питания и кормов для животных. Протокол валидации альтернативных методов

ГОСТ ИСО/МЭК 17025-2009 Общие требования к компетентности испытательных и калибровочных лабораторий

ГОСТ 20015-88 Хлороформ. Технические условия

Примечание - При пользовании настоящим стандартом целесообразно проверить действие ссылочных стандартов в информационной системе общего пользования - на официальном сайте Федерального агентства по техническому регулированию и метрологии в сети Интернет или по ежегодному информационному указателю "Национальные стандарты", который опубликован по состоянию на 1 января текущего года, и по выпускам ежемесячного информационного указателя "Национальные стандарты" за текущий год. Если ссылочный стандарт заменен (изменен), то при пользовании настоящим стандартом следует руководствоваться заменяющим (измененным) стандартом. Если ссылочный стандарт отменен без замены, то положение, в котором дана ссылка на него, применяется в части, не затрагивающей эту ссылку.

     3 Термины и определения


В настоящем стандарте применены следующие термины с соответствующими определениями:

3.1 стартовая культура: Бактериальный препарат, состоящий из специально подобранных технологически значимых живых штаммов микроорганизмов, предназначенный для прямого внесения в мясное сырье при изготовлении сырокопченой и сыровяленой мясной продукции, может производиться в сухой и жидкой формах.

3.2 дезоксирибонуклеиновая кислота; ДНК: Полимер дезоксирибонуклеотидов.

3.3 матрица (материал) пробы: Представленные на испытания продукты, которые могут иметь различия в химическом составе и физическом состоянии.

3.4 обнаружение: Определение наличия целевых фрагментов ДНК микроорганизмов стартовых культур.

3.5 предел обнаружения: Минимальная концентрация целевого микроорганизма в заданном количестве определенной матрицы, которая может быть достоверно обнаружена в условиях, заданных в применяемом методе.

3.6 идентификация: Процесс определения принадлежности целевого микроорганизма, содержащегося в образце, к одному из заданных таксонов.

Примечание - Таксон - группа микроорганизмов, связанных той или иной степенью родства, достаточно обособленная, чтобы ей можно было присвоить определенную категорию того или иного ранга - вид, род, семейство и т.д.

3.7 выделение ДНК: Обработка пробы, высвобождающая ДНК целевого микроорганизма.

3.8 очистка ДНК: Процесс обработки выделенной ДНК, позволяющей повысить ее чистоту.

Примечание - Под чистотой ДНК понимают снижение наблюдаемых и обнаруживаемых эффектов ингибиторов ПЦР в контроле ее ингибирования.

3.9 полимеразная цепная реакция; ПЦР: Ферментативная реакция, позволяющая амплифицировать ДНК in vitro.

3.10 амплификация: Увеличение количества копий специфичной последовательности ДНК в результате ПЦР.

3.11 ПЦР в реальном времени: Метод для обнаружения ПЦР-продуктов во время амплификации.

3.12 ПЦР-продукт: Фрагмент ДНК, амплифицированный в ПЦР.

3.13 подтверждение ПЦР-продукта: Процесс, который показывает, что ПЦР-продукт получен из целевой последовательности.

3.14 праймер: Олигонукледотид* с определенной длиной и последовательностью, комплементарный фрагменту аналитически значимой последовательности ДНК.

________________

* Текст документа соответствует оригиналу. - Примечание изготовителя базы данных.


Примечание - Праймер ограничивает целевую последовательность ДНК.

3.15 целевая ДНК: Выбранная для амплификации последовательность ДНК.

3.16 ДНК-зонд: Меченая молекула нуклеиновой кислоты с определенной последовательностью, используемая для обнаружения целевой ДНК с помощью гибридизации.

3.17 интеркалирующий краситель: Флюоресцентный краситель, интеркалирующий в двуцепочечные молекулы ДНК.

3.18 денатурация ДНК: Процесс, в результате которого двуцепочечная ДНК разделяется на одноцепочечные.

3.19 отжиг: Гибридизация праймера с комплементарной последовательностью ДНК в заданных условиях.

3.20 гибридизация: Специфическое связывание комплементарных последовательностей нуклеиновых кислот в соответствующих условиях реакции.

3.21 элонгация праймера: Ферментативная реакция, приводящая к синтезу новой цепи ДНК путем добавления одиночных рибонуклеотидов к 3'-концу праймера.

3.22 ДНК-полимераза: Термостабильный фермент, катализирующий циклический синтез ДНК.

3.23 мастермикс: Смесь реагентов, необходимых для ПЦР, за исключением целевой ДНК и различных видов контроля.

3.24 амплификатор (термоциклер): Автоматический прибор, выполняющий необходимые для ПЦР циклы нагрева и охлаждения с заданными условиями.

3.25 специфичность: Способность применяемого метода распознавать исключительно целевую последовательность и отличать ее от сходных последовательностей и загрязняющих примесей.

3.26 гены "домашнего хозяйства": Гены, необходимые для поддержания основных клеточных функций микроорганизмов, которые экспрессируются во всех клетках культуры на относительно постоянном уровне.

3.27 ингибиторы ПЦР: Вещества, снижающие эффективность ПЦР или полностью подавляющие ее.

3.28 деконтаминация: Удаление или глубокая фрагментация ДНК и/или нуклеаз из реактивов, с поверхностей оборудования, вспомогательного оборудования и рабочих поверхностей лабораторных инструментов и инвентаря.

     4 Общие положения

4.1 Для выявления стартовых культур в продукте проводят прямую постановку ПЦР с ДНК, выделенной непосредственно из продукта, идентификацию стартовых культур с использованием метода ПЦР в режиме реального времени.

Данный метод можно использовать для установления видовой принадлежности культур, входящих в бактериальные препараты.

4.2 Идентификация основана на выявлении при помощи ПЦР фрагментов ДНК, присутствие которых в анализируемой пробе продукта однозначно свидетельствует о наличии в ней целевого микроорганизма.

4.3 Идентификация стартовых культур состоит из следующих последовательных этапов:

а) выделение ДНК в результате клеточного лизиса и очистка;

б) ПЦР в реальном времени с использованием специфических праймеров.

4.4 ПЦР в реальном времени состоит из трех этапов:

а) денатурация двуцепочечной ДНК (дцДНК);

б) отжиг праймеров на комплементарной целевой последовательности;

в) элонгация гибридизовавшихся праймеров с помощью термостабильной ДНК-полимеразы.

Примечание - Этапы б) и в) могут быть объединены в один в зависимости от свойств ДНК-полимеразы.

     5 Требования безопасности

5.1 Помещение, в котором проводят испытания, должно быть оборудовано приточно-вытяжной вентиляцией по ГОСТ 12.4.021. Содержание вредных веществ в воздухе рабочей зоны не должно превышать норм, установленных ГОСТ 12.1.005.

5.2 Работу необходимо проводить, соблюдая правила личной гигиены и противопожарной безопасности в соответствии с требованиями ГОСТ 12.1.004, и иметь средства пожаротушения по ГОСТ 12.4.009.

5.3 При работе с электроприборами необходимо соблюдать требования безопасности по ГОСТ 12.1.019.

5.4 При подготовке и проведении испытаний необходимо соблюдать требования техники безопасности при работе с химическими реактивами по ГОСТ 12.1.007.

     6 Требования к персоналу

6.1 Персонал, участвующий в проведении исследований, должен иметь соответствующее специальное образование.

6.2 Персонал допускается к работе после прохождения специальной подготовки и инструктажа по соблюдению техники безопасности.

     7 Требования к условиям проведения испытаний

7.1 Основным требованием к организации работы в лаборатории является обеспечение физического разделения ДНК из исследуемых проб и амплифицированной ДНК, полученной в ходе ПЦР. Случайная контаминация ДНК может возникать от пыли и распределения аэрозолей. Организация рабочей зоны в лаборатории и системы управления качеством должны быть основаны:

а) на систематическом выполнении всех методологических этапов, связанных с получением результатов;

б) принципе "прямого потока" при проведении испытаний.

Примечание - Принцип "прямого потока" подразумевает наличие последовательно расположенных изолированных зон для каждого этапа исследования.

7.2 Для предотвращения контаминации реакционной смеси амплифицированными в предыдущих ПЦР целевыми последовательностями ПЦР-лаборатория должна иметь раздельные рабочие зоны с собственными комплектами оборудования:

- зону приема и регистрации;

- зону первичной обработки проб;

- зону выделения ДНК;

- зону для приготовления реакционных смесей (при необходимости);

- зону проведения ПЦР.

7.3 Каждая зона ПЦР-лаборатории должна быть оснащена индивидуальным набором соответствующего лабораторного оборудования, расходных материалов и рабочей одежды. Допускается использование одноразовой рабочей одежды и одноразовых перчаток.

7.4 В ПЦР-лаборатории для обработки полов и стен, а также рабочих поверхностей лабораторной мебели используют дезинфицирующие средства, вызывающие деградацию ДНК в соответствии с действующими нормативными документами государства, принявшего стандарт. Рекомендуется использовать хлорсодержащие препараты.

7.5 Деконтаминация вспомогательного оборудования и реактивов

Керамическую посуду и инструменты из нержавеющей стали деконтаминируют сухим жаром при температуре 160°С в течение 2 ч.

Дистиллированную воду стерилизуют автоклавированием при температуре 121°С в течение 30 мин.

7.6 Утилизацию отходов и их деконтаминацию проводят в соответствии с нормативными документами, действующими на территории государства, принявшего стандарт.

     8 Средства измерений, вспомогательное оборудование, материалы и реактивы


Весы неавтоматического действия по ГОСТ OIML R 76-1 специального или высокого класса точности с пределом допускаемой абсолютной погрешности не более ±0,001 г.

Микропробирки полипропиленовые конические вместимостью 1,5 см с крышкой.

Перчатки резиновые или латексные неопудренные.

Пробирки пластиковые вместимостью 15 см с крышкой.

Шпатели одноразовые.

Гомогенизатор лопаточного типа.

Пакеты для гомогенизации, соответствующие используемому гомогенизатору.

Ступки фарфоровые с пестиком по ГОСТ 9147.

Оксид алюминия, ч.д.а.

Центрифуга для микропробирок вместимостью 1,5 см с частотой вращения не менее 12000 об/мин.

Хлороформ по ГОСТ 20015.

Спирт этиловый ректификованный по ГОСТ 5962.

Амплификатор для ПЦР в реальном времени.

Дозаторы автоматические одноканальные с переменным объемом, повереные* по показателям предела относительной погрешности и предела среднеквадратичного отклонения.     

________________

* Текст документа соответствует оригиналу. - Примечание изготовителя базы данных.


Наконечники к автоматическим дозаторам с аэрозольными барьерами, свободными от ДНКаз и РНКаз.

Спектрофотометр, обеспечивающий определение оптической плотности при длинах волн 256 и 280 нм.

Вода дистиллированная по ГОСТ 6709.

Вода для лабораторного анализа по ГОСТ ISO 3696 1-й степени очистки, свободная от ДНКаз и РНКаз.

Реакционная смесь, в состав которой входят наборы реагентов для приготовления реакционной смеси:

- ДНК-полимераза, представляющая собой очищенный фермент или рекомбинантную форму данного фермента, термостабильная. Использование и хранение - согласно инструкции производителя;

- реакционный буфер, соответствующий требованиям для ДНК-полимеразы. Реагенты, используемые для его приготовления, должны быть стабильны в условиях хранения и в течение реакции амплификации. Допускается применять готовый к использованию буфер;

- дезоксирибонуклеозид трифосфаты (dNTP) для ПЦР. Растворы, содержащие соответствующую концентрацию dATP, dCTP, dGTP, dTTP и/или dUTP. Должны быть стабильны в условиях хранения и в течение реакции амплификации. Допускается применять готовые к использованию растворы;

- смесь праймеров и зондов, подобранных по целевым последовательностям генов исследуемых микроорганизмов. Рекомендуемые целевые последовательности приведены в приложении А;

- хлорид магния по ГОСТ 4209, ч.д.а. Может быть использован как отдельный раствор и/или входить в состав реакционного буфера;

- интеркалирующие красители. Могут быть использованы как отдельный раствор или входить в состав реакционного буфера.

Образец контрольный положительный (К+), содержащий целевую последовательность ДНК исследуемых микроорганизмов.

Образец контрольный отрицательный (К-), не содержащий целевой последовательности ДНК исследуемых микроорганизмов.

Примечание - Реактивы должны быть по качеству не ниже ч.д.а. Растворы реактивов для проведения ПЦР рекомендуется готовить заранее и хранить при температуре минус 20°С.


Допускается применение других средств измерений с метрологическими характеристиками и вспомогательного оборудования с техническими характеристиками, а также материалов и реактивов, по качеству не ниже указанных в настоящем стандарте.

     9 Отбор и подготовка проб, их транспортирование и хранение

9.1 Отбор проб

9.1.1 Отбор проб сырокопченой и сыровяленой мясной продукции проводят по ГОСТ 9792.

9.1.2 При исследовании готовых бактериальных препаратов отбор проб проводят в количестве не менее трех упаковочных единиц от партии.

9.1.3 Отбор проб проводят таким образом, чтобы не происходила перекрестная контаминация (загрязнение одного образца другим). Для этого отбор проб проводят в перчатках, а инструменты, применяемые для отбора и измельчения пробы, используют однократно или после очистки, мойки и деконтаминации. Отбор проб проводят в пластиковую посуду или одноразовые пластиковые пакеты.

9.1.4 Каждую отобранную пробу маркируют этикетками с указанием наименования продукта, предприятия-изготовителя, номера партии, даты отбора проб, цели исследования и с визированием лиц, отбиравших пробу.

9.1.5 Отобранные пробы, предназначенные для исследования вне предприятия-изготовителя, пломбируют и опечатывают печатью организации, отвечающей за контролируемую продукцию, и транспортируют в лабораторию.

9.1.6 Транспортирование проб осуществляется при температуре, рекомендованной для их хранения. Длительность транспортирования не должна превышать срока годности исследуемого продукта. При невозможности доставки пробы в течение срока годности продукта или при исследовании проб, отобранных в течение производственного процесса изготовления продукта, допускается замораживание проб.

9.1.7 Отобранные пробы хранят согласно условиям, указанным производителем, или при необходимости повторного исследования при температуре минус (20±2)°С не более 30 дней.

9.2 Подготовка проб (первичная обработка)

9.2.1 Подготовку проб проводят в условиях ПЦР-лаборатории в зоне первичной обработки проб.

9.2.2 Для анализа мясной продукции отбирают не менее 10 точечных проб массой от 5 до 10 г, каждую измельчают в фарфоровой ступке с добавлением оксида алюминия массой не более 15% от массы точечной пробы до однородного гомогенного состояния. Измельченные точечные пробы помещают в пакет для гомогенизации, перемешивают при помощи одноразового шпателя, формируя объединенную пробу массой от 50 до 100 г. Затем в одноразовую, герметично закрывающуюся пробирку вместимостью 15 см или контейнер отбирают около 10 г объединенной пробы, формируя среднюю пробу, которую маркируют. С целью формирования лабораторной пробы для выделения ДНК в одноразовую микропробирку вместимостью 1,5 см при помощи одноразового шпателя отбирают от 30 до 60 мг гомогенной средней пробы и маркируют.

9.2.3 Для проведения идентификации колоний микроорганизмов, изолированных по ГОСТ 10444.11, выделенных на плотных дифференциально-диагностических средах в результате микробиологического исследования образцов продукции, отбирают изолированную колонию с дифференциально-диагностической среды, суспендируют ее в одноразовой микропробирке вместимостью 1,5 см с 0,2 см стерильной дистиллированной воды и маркируют.

9.2.4 При исследовании бактериальных препаратов от каждой упаковочной единицы отбирают по 5 г препарата в пакет для гомогенизации, добавляют 45 см стерильной дистиллированной воды и суспендируют при помощи гомогенизатора лопаточного типа.

9.2.5 Микропробирки с лабораторными пробами маркируют номером, нанесенным на пробирки (контейнеры) со средними пробами. После формирования лабораторных проб пробирки (контейнеры) с оставшимися средними пробами хранят в условиях, указанных производителем исследуемого продукта, согласно руководству по качеству испытательной лаборатории, разработанному в соответствии с ГОСТ ИСО/МЭК 17025.

     10 Выделение ДНК

10.1 При выделении и очистке ДНК выполняют следующие этапы:

а) получение лизата - разрушение клеточной стенки, денатурация белков с извлечением ДНК в надосадочной жидкости;

б) преципитация образовавшихся пептидов и обезжиривание с органическими растворителями (например, хлороформом), что позволяет оставить ДНК в водной фазе;

в) очистка раствора ДНК с использованием силики , магнитных частиц и колонок;

г) сбор преципитата ДНК с помощью центрифугирования;

д) промывка ДНК этиловым спиртом и ресуспендирование в элюирующем буфере.

Для продуктов с высоким содержанием жира необходимо использовать протоколы выделения ДНК, включающие этап обработки лизата хлороформом.

10.2 Качество и выход выделенной ДНК должны быть как повторяемыми, так и воспроизводимыми применительно к амплификации в ПЦР при условии достаточного содержания ДНК в матрице. В частности, применяемый метод должен обеспечивать получение фрагментов ДНК, средний размер которых более или равен размеру исследуемых ПЦР-продуктов.

Концентрацию ДНК определяют на спектрофотометре при длине волны 256 нм в кювете с толщиной слоя 1 см. Критерием чистоты выделенной ДНК является соотношение значений оптической плотности раствора ДНК при длинах волн 256 и 280 нм. Для чистых препаратов ДНК указанное соотношение выше 1,7.

Допускается для определения концентрации ДНК пользоваться флуориметрическими методами с использованием флуоресцентных зондов.

Следует избегать повторных процессов замораживания и размораживания растворов ДНК.

Для хранения ДНК с низким количеством копий используют подходящую пластиковую посуду.

     11 Проведение испытаний

11.1 Проведение ПЦР в реальном времени

Выделенную ДНК при помощи одноканальных дозаторов добавляют в реакционную смесь и выполняют остальные этапы ПЦР на амплификаторе с использованием соответствующих профиля "температура - время" и количества циклов для системы праймеров и реакционной смеси, используемых в соответствии с методом ПЦР. Отсутствие ингибирования ПЦР должно быть подтверждено использованием соответствующих контролей (например, внутреннего положительного контроля). Амплификация ДНК - циклический процесс, состоящий из следующих этапов:

а) после денатурации двуцепочечной ДНК два однонуклеотидных праймера отжигаются (гибридизируются) на целевой амплифицируемый сегмент;

б) двуцепочечные участки формируются в результате специфического соединения оснований между праймерами и целевой последовательностью, ограничивающими амплифицируемый сегмент ДНК и выполняющими роль позиций начала синтеза ДНК с помощью термостабильный ДНК-полимеразы;

в) повторяющийся циклический процесс тепловой денатурации, отжига праймеров и синтеза ДНК приводит к практически экспоненциальной амплификации ограниченного праймерами сегмента ДНК.

Детекцию продуктов амплификации при постановке ПЦР в реальном времени проводят методом измерения флуоресценции интеркалирующих красителей или флуоресцентных меток ДНК-зондов в процессе амплификации.

11.2 Контроль процедуры испытаний

Виды контроля, необходимые для обнаружения целевых микроорганизмов в мясной продукции методом ПЦР в реальном времени, приведены в таблице 1.


Таблица 1

Наименование этапа

Положительный
контроль
выделения*

Отрицательный
контроль
выделения

Внутренний
контроль
амплификации**

Положительный
контроль
ПЦР***

Отрицательный
контроль
ПЦР***

Выделение ДНК

+

+

-

-

-

Наименование этапа

Положительный
контроль
выделения*

Отрицательный
контроль
выделения

Внутренний
контроль
амплификации**

Положительный контроль ПЦР***

Отрицательный контроль ПЦР***

Амплификация

+

+

+

+

+

Обнаружение

+

+

+

+

+

* Положительный контроль выделения представляет собой культуру целевого микроорганизма, внесенную в мясной продукт в концентрации не менее 110 КОЕ/г. Положительный контроль выделения необходим при постановке каждой новой партии набора для выделения ДНК.

** В случае необходимости проводят внутренний контроль амплификации.

*** Контроль необходим для каждой партии проб в амплификаторе.

Примечание - Знак "+" означает, что на данном этапе используют контроль, знак "-" - не используют.


Если один из основных контролей не дал ожидаемого результата, то в процедуру испытаний следует включать дополнительные контроли (периодически или в каждую реакцию).

11.3 Подтверждение результатов

Подтверждением результатов амплификации с использованием интеркалирующих красителей является постановка анализа плавления на амплификаторе с использованием прилагающегося программного обеспечения с последующим сравнением пиков производных кривых плавления образцов с пиками производной кривой плавления положительного контроля.

11.4 Основные требования к ПЦР в реальном времени

Условия реакции и параметры циклов должны быть оптимизированы для каждой пары праймеров или систем "праймер - зонд". Если видовую идентификацию стартовых культур методом ПЦР проводят в первый раз, следует убедиться в том, что условия реакции обеспечивают достижение предела обнаружения. Предел обнаружения для ПЦР - это минимальное количество целевой ДНК, необходимой для получения сигнала в течение минимум 40 циклов амплификации. Предел обнаружения должен составлять не более 100 копий целевой ДНК в объеме реакционной смеси.

Необходимо достигать максимальной специфичности реакции, например применяя ПЦР с горячим стартом. Данный метод повышает специфичность за счет снижения побочных реакций, таких как амплификация нецелевых последовательностей, образование димеров праймеров и т.д.

11.5 Требования к подбору праймеров

Эффективность каждой специфичной ПЦР должна быть сопоставима с другими специфичными ПЦР, для этого необходимо следовать ряду условий в ходе дизайна праймеров:

а) длина каждого праймера должна находиться в пределах от 18 до 30 базовых пар нуклеотидов ();

б) соотношение GC:АT в составе праймеров должно быть приближено к 50:50;

в) не должно встречаться отдельных участков праймеров, идущих подряд G и С;

г) следует избегать комплементарности праймеров и зонда по 3'-концу во избежание образования димеров;

д) не должно образовываться внутренних вторичных структур ("шпилек").

Для подбора праймеров используют доступное программное обеспечение. Последовательности генов, по которым возможно проводить подбор праймеров, приведены в приложении А.

11.6 Подтверждение специфичности праймеров

Необходимо подтверждать способность праймеров обнаруживать целевую последовательность ДНК.

Специфичность праймеров может быть оценена теоретически или эмпирически. Рекомендуется использовать оба подхода.

Теоретическую оценку должны проводить сравнением последовательности праймера с геномами в имеющихся открытых базах данных*.

________________

* Например, в базе данных NCBI с использованием программы BLAST-online. Данная информация является рекомендуемой, приведена для удобства пользователей настоящего стандарта и не исключает возможности использования другой базы данных.


Эмпирическую оценку проводят путем постановки ПЦР с использованием тестируемых праймеров и ДНК, родственных целевому микроорганизмов. Требования к подтверждению специфичности праймеров к целевым видам микроорганизмов следует устанавливать по ГОСТ ISO 16140.

     12 Обработка и оформление результатов

12.1 Обработка результатов

Интерпретация возможна, если результаты, приведенные в 11.2, не противоречат друг другу.

Результаты ПЦР и их интерпретация приведены в таблице 2.


Таблица 2

Исследуемая проба

Положительный контроль ПЦР

Отрицательный контроль выделения

Внутренний контроль амплификации

Интерпретация результатов

+

+

-

+/-

Положительный

-

+

-

+

Отрицательный

-

+

+

+/-

Неоднозначный

-

+

-

-

Неоднозначный

Возможна контаминация.

Возможно ингибирование.

Примечание - Знак "+" означает, что обнаружен ПЦР-продукт, знак "-" - не обнаружен ПЦР-продукт, знак "+/-" - результат контроля не соответствует ожидаемому.

12.2 Оформление результатов

Протокол исследования должен включать в себя следующую информацию:

- полную информацию, необходимую для идентификации лабораторной пробы;

- любую конкретную информацию, относящуюся к лабораторной пробе (например, недостаточное количество, плохое состояние);

- ссылку на использованный стандарт и методы исследования;

- дату приема пробы на исследование;

- условия хранения;

- дату начала/окончания исследования;

- информацию об ответственном исполнителе исследования;

- массу или объем исследуемой пробы;

- результаты исследования;

- любые конкретные замечания, возникшие в ходе исследования;

- любые отклонения, добавления или изменения.

Приложение А
(рекомендуемое)

     

Последовательности генов "домашнего хозяйства" целевых видов микроорганизмов, рекомендуемые для подбора праймеров и зондов

А.1 В приложении приведены прочтения генов "домашнего хозяйства", рекомендуемых для дизайна видоспецифических праймеров. Перечислены прочтения только для тех видов, для которых в базе данных* есть референсные сиквенсы.

_______________

* Например, в базе данных NCBI. Данная информация является рекомендуемой, приведена для удобства пользователей настоящего стандарта и не исключает возможности использования другой базы данных.


В случае отсутствия в международных базах данных референсных сиквенсов для иных видов микроорганизмов допускается использовать прочие (неподтвержденные) прочтения соответствующих генов.

Для подбора видоспецифических праймеров рекомендуется использовать следующие гены: ген рекомбиназы субъединица (rесА), ген гиразы субъединица (gyrB).

А.1.1 Lactobacillus sakei

Референсный сиквенс - Lactobacillus sakei strain 23K complete genome, NCBI Reference Sequence: NC_007576.1. Ген rесА**

_______________

** Данная информация является рекомендуемой, приведена для удобства пользователей настоящего стандарта и не исключает возможности использования другой базы данных.

TTGGCTAAAGATGAAAGACAAGCAGCACTTGATGCTGCCCTAAAGAAGATTGAAAAGAATTTTGGTAAAGGTTC
AATTATGCGAATGGGTGAAAAGGTTGATACACAAGTCTCAACAGTTTCATCTGGTTCATTGGCATTGGACGAAGCGCT CGGAGTAGGTGGTTATCCTCGCGGCCGGATCGTTGAAATTTACGGTCCTGAAAGTTCAGGTAAAACAACCGTTGCGT TACATGCTGTTGCAGAAGTGCAAAAGCAAGGTGGAACGGCTGCTTATATCGATGCTGAAAATGCGATGGATCCTAAGT ATGCAACAGCACTTGGCGTTAATATTGATGACTTACTCTTGTCACAACCTGATACTGGTGAACAAGGCTTAGAAATTGC TGATGCCTTGGTATCAAGTGGGGCCGTTGATATTTTAGTTGTCGATTCAGTTGCTGCTTTGGTACCACGTGCTGAAATC GAAGGCGAAATGGGTGACGCCCACGTTGGCTTACAAGCCCGTTTGATGTCACAAGCCTTACGTAAATTATCAGGGAC GATTAATAAGACGAAGACGATTGCGTTATTCATTAACCAAATTCGTGAAAAAGTCGGCGTGATGTTTGGTAACCCCGAA GTCACACCAGGTGGTCGTGCTTTGAAGTTCTACTCAACTGTTCGGCTTGAAGTGCGTCGTGCTGAAACCATCAAAAA TGGGACAGATATGATTGGGAACCGGGCCCGAATCAAAGTCGTTAAGAATAAGGTTGCGCCACCATTTAAGGTCGCTG AAGTTGATATCATGTACGGTCAAGGGATTTCCAGAACCGGTGAATTGGTTGATATGGCGGTCGAAAAAGACATTATCAA TAAGAGTGGTTCTTGGTACTCTTATGGCTCAGAACGAATTGGCCAAGGGCGAGAAAATGCTAAGAACTATTTGGCTGA TCACGAAGATGTCGAAGATGAAGTTCGTTTGAAGGTCAGAGCAGCTTATGGTATTTCAGATGTACCTGAAGAAGATCT
CCCAACAACTGAAGATGAACAAATAAATATTTTACCAGATGATTCAACAGAAGAATAA


A.1.2 Lactobacillus plantarum

Референсный сиквенс - Lactobacillus plantarum WCFS1, complete genome, NCBI Reference Sequence: NC_004567.2 Ген recA**

_______________

** Данная информация является рекомендуемой, приведена для удобства пользователей настоящего стандарта и не исключает возможности использования другой базы данных.

    CTATTTTTCGGTTGGTTGGTCGCCGAGATCGAGAGCAGTTTCCGCTGGTGTCGCTTTAGTGGACTTACTTTGA CCTTTACTGCCATTCTTAGCAGTTCCCTTATCCTTAGCTTCTTTGGCCTGATCATCAGTTTCAGACGTTTCTTCACCAGT TGCATCCATACCGTATGCATCACGAACCTTTTGGCGAATCTCCGTCATGACATCAGGATGCTCGTCCAAATACTTCTTG GCATTTTCACGGCCTTGACCAATGCGATCGTCACCATATGAATACCAAGAACCACTCTTCTTAACAATATCCTTTTCAG CAGCCATATCAACAATTTCACCAGTTTGTGAGATACCTTGACCATACATGATATCCACTTCGGCACGCTTAAATGGCGG TGCAACCTTGTTCTTAACGACTTTGATCCGGACACGGTTACCAATAATATTGGTTCCTTCCTTGATCTGTTCTGCCCGC CGTACTTCCAAACGAATCGTGGCGTAAAATTTCAAGGCCCGACCACCAGGAGTCGTTTCAGGATTACCAAACATCACA CCAACTTTTTCACGAATTTGATTGATAAATAACGCGATTGTCTTGGTTTTGTTCAATGTCCCTGATAACTTCCGGAGCG CTTGTGACATCAGCCGCGCTTGTAACCCAACGTGTGCGTCACCCATTTCACCTTCAATTTCGGCACGTGGCACTAAG GCCGCCACCGAGTCAACAACTAAAATATCGACCGCACCACTGGAAACTAAGGCATCTGCAATTTCAAGCCCTTGTTCA CCAGTATCTGGTTGCGAAAGTAACAGGTCATCAATGTTGACCCCTAGGTGTTCCGCATAAACGGGGTCTAGTGCGTTT TCAGCATCGATATAGGCCGCCGTACCACCCTGCTTTTGAACTTCAGCAACCGCATGTAGTGCCACGGTCGTTTTACCT GAACTTTCAGGACCGTAGATTTCCACGATCCGACCACGTGGGTAGCCGCCGACACCCAACGCGTCATCTAAGGCCA
ACGATCCACTTGAAATCGTTGAAATAGTCGTCTGGGCAGCGTCACC


А.1.3 Staphylococcus carnosus

Референсный сиквенс - Staphylococcus carnosus subsp. carnosus TM300 complete genome, NCBI Reference Sequence: NC_012121.1. Ген gyrB*

_______________

* Данная информация является рекомендуемой, приведена для удобства пользователей настоящего стандарта и не исключает возможности использования другой базы данных.

TAGAAATCCAAGTTCGCATATACAGCGTTGTCTTCGATGAATTGTCTACGATTTTCAACCACATCGCCCATCAACA TTTCAAATGTCGTATCCGCTTCAATCGCATCTTCTAATGTAACTTGAAGCATTGAACGGTGTTCTGGGTTCATTGTTGTT TCCCATAATTGGTCAGCATCCATTTCTCCTAAACCTTTATAACGAGAGATTGACCATTTTGGTGTTGGTTTCAATTCTGAT TTTAATTTTTCCAATTCTCTTTCGTTGAAGACATAATATTTTTGTTTGCCTTGTGTCAATTTGAACAATGGCGGCTGTGCA ATATAAACATATCCTGCTTCAATCAACGGGCGCATAAAGCGGTAGAAGAATGTTAACAAGAGTGTTCTGATATGGGCACC GTCGACATCGGCATCTGTCATAATAACGATTTTATGATAACGTGCTTTAGAAATATCAAATTCTCCGCCGATTCCTGTACC GAATGCAGTAATCATTGAGCGGATTTCATTATTATTTAAAATTCTGTCTAAGCGTGATTTTTCAACGTTCAAGATCTTACC GCGCAATGGTAAAATCGCTTGTGTTCTAGAGTCACGTCCAAGTTTTGTAGACCCTCCGGCAGAGTCACCTTCGACTAA GAAGATTTCACTTTCTTCAGGGTTTTTACTTGAGCAGTCTGCTAATTTACCAGGTAAGCTGGAAACTTCTAAAGCAGATT TTCTACGTGTTACTTCACGTGCTTTTTTAGCTGCAATACGTGCACGAGAAGCCATCAGACCTTTTTCGATAATAATACGT GCAACTTGCGGATGTTCATACAAGAAACGTTCCATATCTTCAGCGGAAAGTCTGTCTACAATCTGACGTACTTCAGAGT TGCCGAGTTTTGTTTTTGTTTGTCCTTCGAACTGAGGATCTTCGTGTTTGATTGAGACAATTGCTGTCATACCTTCACG TGTATCTTCACCAGACAAACGTTCTTTATCCTCTTTGATTAAACCTGATTTTGTACCATAGCTGTTTAACACACGTGTTAA GGCGCGTTTGAAGCCATCTTCATGCGTTCCGCCTTCGTAAGTGTGAATGTTATTCGCATAAGATAATAAGTTTGTTGTG AAGCCGCTATTATATTGAATTGCGATTTCAACTTCTACATCATCTTTACGATCATGAACATATACAGGTTCATCAAATAAAG GTTCTTTATTTTCATTCAATAATTCTACGTAAGACTTAATACCGCCTTCATAGTGGTATGAATCTTCGCGAATATTATCTTC ATCACGTTCATCACGTAAAGAGATTTGAATGCCTTTATTCAAGAAAGCCAATTCTCTAATACGTTTTTGTAATACTTCGTA TTGGTAAGTCGTTGTTTCTGTAAAAATTTCAGGATCGGCTTTGAAACGGATTTCTGTACCGTTATGTTCTGTTTCGCCGA TGACTTTCAAATCATATTGCGGAATACCGCGTTTATAAGCTTGATTATAAATTTTATTATTTCGGTGAACATAGACTTCTAA GTCTTCTGATAGTGCGTTTACAACAGATGAACCTACACCATGCAATCCACCTGAAACTTTGTATCCGCCGCCGCCGAAT TTACCTCCGGCATGTAAAACAGTTAAGATAACTTCAACTGCAGGACGTCCCATTTTTTCTTGAATATCAACAGGAATACC ACGTCCGTTATCTGTTACTCGAATCCAATTATCTTTTTCGATAATGACTTCGATTTTATCAGCATAGCCAGCTAATGCTTC GTCAATACTATTGTCCACAATTTCCCAAACTAAATGGTGCAGACCTCTTTCTGAAGTTGAACCAATATACATACCTGGTC GCTTACGAACCGCTTCAAGTCCTTCTAAAACTTGAATTTGTCCAGCACCATAATTTTCCGTGTTGTTCACATCTGACAAT

A.1.4 Pediococcus pentosaceus

Референсный сиквенс - Pediococcus pentosaceus ATCC 25745, complete genome, NCBI Reference Sequence: NC_008525.11. Ген gyrB*

_______________

* Данная информация является рекомендуемой, приведена для удобства пользователей настоящего стандарта и не исключает возможности использования другой базы данных.

    TTGGCAGACGAAAAAGAAACGAAAGCAGAATTAGCCAGAGAATATGATGCGAGTCAAATTCAGGTTTTAGAG GGGCTCGAAGCAGTTCGTAAACGCCCAGGGATGTATATTGGGTCGACTAGTTCTCAAGGACTACACCATTTGGTTT GGGAAATTATTGATAATGGTATTGATGAAGCTCTTGCAGGATTTGCAGACAAAATTGATGTGATCGTTGAAAAAGACAAT AGCATTACCGTCACTGATAATGGACGTGGGATTCCGGTTGATATCCAAAAGAAAACTGGAAAACCAGCTTTAGAAACA GTCTTTACGGTCCTACATGCCGGAGGTAAATTCGGCGGTGGCGGTTATAAAGTTTCTGGAGGATTGCATGGTGTGGG TGCATCCGTTGTAAATGCGTTATCAACGGAATTAGATGCGCGCGTCATGAAGGACGGTAAAATCTACTACATTGATTTT GCGCTAGGAAAAGTAAAAACACCGATGAAAACGATTGGTGATACTGAACATCCTGACGATCATGGAACTATTGTTCATT TCGTTCCAGATCCAGATATTTTCCAAGAAACTACCACATATGACATTAATATCTTAAAAACACGAATTCGTGAATTAGCCT TTTTGAACAAGGGTCTACGGATTACTTTGAAGGATATGCGTCCTGAAAAGCCAACTGAAGACGACTTCTTGTACGAAG GTGGGATTCGCCACTACGTTGAATACTTAAACGAAGGCAAAGAAGTAATTTTCCCTGAACCTATCTATGTTGAAGGGGT TACAAAAGGTATCACTGTTGAAGTAGCTATGCAATATATCGAAGGTTATCAAAGTAAATTGTTAACTTTTACTAACAATATT CATACCTACGAAGGCGGTACCCACGAAGAAGGTTTCAAACGTGCTTTAACACGAGTTATTAACGATTACGCTAAAAAC AACAATATTTTAAAAGAAAATGATGATAAATTGTCTGGTGATGATGTTCGAGAAGGTTTGACGGCAGTAGTCAGCGTTA AGCATCCTGATCCTCAATTCGAAGGACAAACGAAAACAAAATTGGGTAACTCAGATGCTCGGACAGCTGTTAACGAAG TGTTTGCTGAAACTTTCAATAAATTCTTATTGGAAAATCCTAAGGTTGCACGTCAAATTGTTGATAAGGGAATCTTGGCA GCAAAAGCACGAGTTGCCGCTAAACGAGCTCGTGAAGTTACGCGTAAGAAGAGTGGCCTAGAACTCAATAATCTTCC TGGTAAATTAGCTGATAATACTTCTAAGGATCCTTCAATTAGTGAATTATTCATTGTCGAGGGTGATTCTGCCGGTGGTA GTGCTAAGTCCGGACGTTCGCGTCTCACACAAGCTATTTTGCCAATTCGTGGGAAGATTTTGAACGTTGAAAAAGCCA CTTTGGATCGGGTTTTGGCCAATGAAGAAATTCGTTCACTCTTTACAGCGCTCGGAACTGGATTTGGTGAGGACTTTG ATGTAAGTAAAGCCAACTATCATAAATTGATTATCATGACCGATGCCGATGTCGATGGTGCTCATATTCGGACACTATTA TTGACGCTGTTCTATCGTTACATGCGTCCAATGATTGATGCAGGATTTGTTTACATTGCTCAACCACCGCTCTACCAAG TACGTCAAGGTAAGATGATCCAATATATCGATTCTGATGAAGAATTAGAAACAGTACTTGGACAATTATCACCATCACCA AAACCTGTAATTCAACGTTATAAAGGTCTTGGTGAAATGGATGCTGAGCAACTTTGGGAAACAACCATGAATCCAGAA AATCGACGCTTGTTACGAGTTTCAGCCGAAGATGCTGATGCTGCAAGTGGTGATTTTGAAATGTTGATGGGTGACAAG GTTGAACCACGTCGTAAATTCATTGAAGAGAACGCTGTGTTTGTTAAAAACTTGGATATCTAA


УДК 57.083.18:637.523:006.354

МКС 67.120.10

Ключевые слова: продукция мясная сырокопченая, продукция мясная сыровяленая, стартовые культуры, видовая идентификация, полимеразная цепная реакция в режиме реального времени, общие требования




10 закупок
ЗМО
Архив
553 603,63 Р
ЗМО
Архив
535 771,60 Р
ЗМО
Архив
491 763,92 Р
ЗМО
Архив
584 391,38 Р
ЗМО
Архив
582 817,51 Р
ЗМО
Архив
481 009,66 Р
ЗМО
Архив
593 335,24 Р
ЗМО
Архив
225 277,60 Р
ЗМО
Архив
599 994,91 Р
ЗМО
Архив
599 994,91 Р
Свободные
Р
Заблокированные
Р
Роль в компании Пользователь

Для продолжения необходимо войти в систему

После входа Вам также будет доступно:
  • Автоматическая проверка недействующих стандартов в закупке
  • Создание шаблона поиска
  • Добавление закупок в Избранное